AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i319_bsub_mtub_300.orf -o319_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 comGB 52 probably part of the DNA transport machinery #2 comGA 300 late competence gene Motif number 1 CTGGTTGTTAAAGGATCAAGCCAGGTTATTAAAGAG 1 17 1 AAACAACGGT 0.993856 -36 AAGCCAGGTTATTAAAGAGGCTCGGTGAA 1 34 1 ATAGAGCGGT 0.992697 -19 AGATCGCCTAATGCAACAATACCGGTCATTTGGTCA 2 20 0 ATACAAAGGT 0.982039 -281 TGAAAATGGAATCTAGCAGGCATGGTGACCATGTCT 2 99 1 ATACAGCGGT 0.997766 -202 CCTATAAATAAAAAAGCAGACATGGTCACCATGCCT 2 116 0 AAACAGCGGT 0.997916 -185 CATATTGTAGAAAAAGAAGAAAAGGTAATCAAACAG 2 252 0 AAAAAGAGGT 0.968757 -49 ** * *** * *** Masking position 8 Map Score: 7.79922 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 56 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 GTCAATAAGCGAAAACAGCATAATGAAAATG 2 76 1 GAAAAAGCAT 0.9667 -225 ACAGCATAATGAAAATGGAATCTAGCAGGCA 2 90 1 GAAAAGGAAT 0.995762 -211 TTTCTGGCAAGAAAAAAGACTTTCAACTGAA 2 176 0 GAAAAAGACT 0.960675 -125 GTTATATGCTGAAAAACCAATTCTTTCTGGC 2 199 0 GAAAACCAAT 0.94988 -102 ATCAAACAGGGAAAACGTGATTTTGTGAGAT 2 230 0 GAAAAGTGAT 0.9667 -71 AGAAAAAGAAGAAAAGGTAATCAAACAGGGA 2 249 0 GAAAAGTAAT 0.987561 -52 TGCGTTGAAAGGAGAGGGAATCAAA 2 286 1 GGAGAGGAAT 0.956981 -15 ***** ***** Masking position 5 Map Score: 6.45906 Number of sites scoring better than the average of aligned sites = 747 Number in coding regions = 661 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 96 Fraction of orfs with sites within 600 bp upstream = 0.0154192 Motif number 3 CTTGATCCTTTAACAACCAGACTTTT 1 4 0 TAACAACCGT 0.988446 -49 CGAGCCTCTTTAATAACCTGGCTTGATCCTTTA 1 25 0 TAATAACCGT 0.994762 -28 GAAAATGACCAAATGACCGGTATTGTTGCATTA 2 15 1 AAATGACCGT 0.992369 -286 TGTTTTCGCTTATTGACCAGTATCTTTCTCAAC 2 60 0 TATTGACCGT 0.99237 -241 GGGAAAATTATAATGACAGGGGTACATTCAGTT 2 150 1 TAATGACAGT 0.987951 -151 ******** * * Masking position 6 Map Score: 4.83583 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 43 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 GGTATTGTTGCATTAGGCGATCTTTCCGTT 2 33 1 CATTAGGCGA 0.991701 -268 AGATACTGGTCAATAAGCGAAAACAGCATA 2 68 1 CAATAAGCGA 0.987748 -233 ATTCCATTTTCATTATGCTGTTTTCGCTTA 2 81 0 CATTATGCTG 0.967243 -220 TCTTTTTCTACAATATGCGTTGAAAGGAGA 2 271 1 CAATATGCGT 0.987747 -30 ********** Masking position 5 Map Score: 2.33926 Number of sites scoring better than the average of aligned sites = 136 Number in coding regions = 123 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 CCAGTATCTTTCTCAACGGAAAGATCGCCT 2 47 0 TCTCAACGGA 0.994976 -254 GAAAAAAGACTTTCAACTGAATGTACCCCT 2 167 0 TTTCAACTGA 0.988665 -134 TTCCCTCTCCTTTCAACGCATATTGTAGAA 2 276 0 TTTCAACGCA 0.992326 -25 ********** Masking position 5 Map Score: 1.95462 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 13 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0