AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i327_bsub_mtub_100.orf -o327_bsub_mtub_100.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 lepA 133 GTP-binding protein Motif number 1 GTACGTGAAAGAGAAAAGCAACCCAG 1 7 1 GAAAGAGAAA 0.997934 -127 ACCCAGATATGATAGGGAACTTTTCTCTTT 1 31 1 GATAGGGAAC 0.99477 -103 TGTAAAACAAGAAAGAGAAAAGTTCCCTAT 1 42 0 GAAAGAGAAA 0.997934 -92 ********** Masking position 4 Map Score: 5.10395 Number of sites scoring better than the average of aligned sites = 112 Number in coding regions = 87 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 GTACGTGAAAGAGAAAAGCAACCCAGATAT 1 11 1 GAGAAAAGCA 0.994558 -123 AAACAAGAAAGAGAAAAGTTCCCTATCATA 1 38 0 GAGAAAAGTT 0.991604 -96 CAATCCTATTGATATAATCTAAGCTAGTGT 1 83 1 GATATAATCT 0.960882 -51 ********** Masking position 6 Map Score: 0.608161 Number of sites scoring better than the average of aligned sites = 264 Number in coding regions = 221 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 GAAAAGTTCCCTATCATATCTGGGTTGCTT 1 26 0 CTATCATATC 0.975675 -108 TGAATCTTTACAATCCTATTGATATAATCT 1 73 1 CAATCCTATT 0.995661 -61 AATCTATCACTCCTACTATTAAACGCA 1 117 0 CACTCCTACT 0.993871 -17 ********** Masking position 8 Map Score: 0.650889 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 27 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0