AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i331_bsub_mtub_300.orf -o331_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 kdgK 37 2-keto-3-deoxygluconate kinase #2 kdgR 221 transcriptional regulator (LacI family) Motif number 1 TAAGAGGAGGTTGGGAAGAG 1 28 1 TTGGGAAGAG 0.992356 -10 TAAAATTTTCTTTGAAACCGTTACCAAAAT 2 57 0 TTTGAAACCG 0.990934 -165 AGGATAAATAGTGAAAAGAGTCAACGAAAA 2 86 1 GTGAAAAGAG 0.950861 -136 ATTTTAAAATTTGGGAAGAGTTTTTTTAAT 2 135 0 TTGGGAAGAG 0.992356 -87 TGAAACCGATTTCAAAACCGTTACAACAAA 2 176 0 TTCAAAACCG 0.968792 -46 ATCTCATATATTTGAAACCGATTTCAAAAC 2 188 0 TTTGAAACCG 0.990934 -34 ********** Masking position 6 Map Score: 8.40546 Number of sites scoring better than the average of aligned sites = 351 Number in coding regions = 302 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 2 GAAACCGTTACCAAAATATTTTCATTCAAG 2 44 0 CCAAAATATT 0.987007 -178 ACTATTTATCCTAAAATTTTCTTTGAAACC 2 68 0 CTAAAATTTT 0.979533 -154 ATATGTCAATTCATTATTTTTTCGTTGACT 2 104 0 TCATTATTTT 0.86298 -118 AAAAACTCTTCCCAAATTTTAAAATTATGG 2 140 1 CCCAAATTTT 0.991561 -82 CAAAAGAATACCATAATTTTAAAATTTGGG 2 150 0 CCATAATTTT 0.987007 -72 GCTCCTGTATCTCATATATTTGAAACCGAT 2 196 0 CTCATATATT 0.919392 -26 ********** Masking position 6 Map Score: 7.7076 Number of sites scoring better than the average of aligned sites = 395 Number in coding regions = 328 Number in noncoding regions = 67 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 3 CTAGGTGCCCTCAACTAAGAGGAGGTTGGG 1 13 1 TCAACTAAGA 0.972056 -25 CAGCATCACTTGAATGAAAATATTTTGGTA 2 36 1 TGAATGAAAA 0.971389 -186 GGTAACGGTTTCAAAGAAAATTTTAGGATA 2 62 1 TCAAAGAAAA 0.989075 -160 GTGAAAAGAGTCAACGAAAAAATAATGAAT 2 96 1 TCAACGAAAA 0.995757 -126 ********** Masking position 4 Map Score: 3.6543 Number of sites scoring better than the average of aligned sites = 182 Number in coding regions = 156 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 TGATGCTGAAATCCTAACCAAGGGGGAAAT 2 14 0 ATCCTAACCA 0.908126 -208 TTTCTTTGAAACCGTTACCAAAATATTTTC 2 51 0 ACCGTTACCA 0.996154 -171 TTTTTCGTTGACTCTTTTCACTATTTATCC 2 87 0 ACTCTTTTCA 0.953783 -135 TATTAAAAAAACTCTTCCCAAATTTTAAAA 2 134 1 ACTCTTCCCA 0.980892 -88 CGATTTCAAAACCGTTACAACAAAAGAATA 2 170 0 ACCGTTACAA 0.975649 -52 TATATTTGAAACCGATTTCAAAACCGTTAC 2 182 0 ACCGATTTCA 0.937762 -40 ********** Masking position 1 Map Score: 4.78091 Number of sites scoring better than the average of aligned sites = 634 Number in coding regions = 570 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 5 TCCTAGGTGCCCTCAACTAAGAG 1 3 1 CTAGGTCCCT 0.983241 -35 TATTTTCATTCAAGTGATGCTGAAATCCTAA 2 27 0 CAAGTGTGCT 0.989939 -195 ACTCTTTTCACTATTTATCCTAAAATTTTCT 2 76 0 CTATTTTCCT 0.97723 -146 TCAAGTGCTCCTGTATCTCATA 2 210 0 CAAGTGTCCT 0.996223 -12 ****** **** Masking position 3 Map Score: 0.19411 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 90 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 6 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0