AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i332_bsub_mtub_300.orf -o332_bsub_mtub_300.ace -a/home/amcguire/genomes/ORF_bsub.txt -z/home/amcguire/genomes/bsub.fna -g0.55 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.55 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yunH 174 similar to allantoinase #2 yurH 300 similar to N-carbamyl-L-amino acid amidohydrolase Motif number 1 AGCGCATTCTCCTTTTCTATAAAAACATTG 1 1 1 ACGTTCCTTT 0.980581 -174 TAGGAATTCTAGCGGTTTTGCTGATGTAATACGATCATAG 1 62 1 ACGTTTCGTT 0.997052 -113 ATGTCAGGATGACGATTTTCCATGTCAGTTTATGTAACAC 1 133 0 GCGTTTCTTT 0.991029 -42 TTTGCGGGCTGCCGGCATTTCTGTTTTCATCCGTTCCGCG 2 19 1 GCGATTCGTT 0.979324 -282 TTCCGCGAACATCGCCTCTCCAGCTTAGCTTGTTCATATG 2 52 1 ACGTCTCGTT 0.990331 -249 TCTCTTCCTTACCGTGTTTTCTTTTGACCTTTACATCAAA 2 128 1 ACGTTTCTTT 0.993945 -173 CTAAAAAATAAACGTTTTTTTGGTTAATCTGTCAATGAAC 2 216 1 ACGTTTTGTT 0.977767 -85 * ** *** * * * * Masking position 15 Map Score: 7.50044 Number of sites scoring better than the average of aligned sites = 217 Number in coding regions = 199 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 TCGTCATCCTGACATGGGGGGATCAAT 1 158 1 GCATGGGGGG 0.993683 -17 CAGCAAGAGCGAAAGAGAGGGTCAAAATGCC 2 95 0 GAAGAGAGGG 0.988265 -206 AAGGAAGAGAGCCAGCAAGAGCGAAAGAGAG 2 107 0 GCAGCAAGAG 0.969115 -194 AGAAAACACGGTAAGGAAGAGAGCCAGCAAG 2 119 0 GAAGGAAGAG 0.966052 -182 AAATAGTTGTGACATGTAGGGTGTATCTGGT 2 166 1 GCATGTAGGG 0.97949 -135 CACCATAGCGGCCAGAGGGGGGAGTAC 2 284 1 GCAGAGGGGG 0.995183 -17 * ********* Masking position 4 Map Score: 4.76424 Number of sites scoring better than the average of aligned sites = 206 Number in coding regions = 169 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 3 ATTGAAAATTATTCACCTTAACCAATGTTT 1 33 0 ATTCACCTTA 0.875704 -142 ATACGATCATAGTAGCAGTAAACTGTTGAA 1 90 1 AGTAGCAGTA 0.831323 -85 GTATCCATCCAGCAACCAGATACACCCTAC 2 181 0 AGCAACCAGA 0.968434 -120 TTTATTTTTTAGCCACAGTATCCATCCAGC 2 198 0 AGCCACAGTA 0.958945 -103 TCATTGACAGATTAACCAAAAAAACGTTTA 2 224 0 ATTAACCAAA 0.717587 -77 TTATAGAAGGAGCAACATGATAGTTCATTG 2 248 0 AGCAACATGA 0.912025 -53 TCTATAATGAAGTCACCATAGCGGCCAGAG 2 271 1 AGTCACCATA 0.973689 -30 ********** Masking position 1 Map Score: 0.721961 Number of sites scoring better than the average of aligned sites = 515 Number in coding regions = 447 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 4 AGGAATTCTAGCGGTTTTGCTGATGTAATA 1 63 1 GCGGTTTTGC 0.959015 -112 CACAACCAGTTCTATTTTCAACAGTTTACT 1 106 0 TCTATTTTCA 0.943877 -69 TGTCAGGATGACGATTTTCCATGTCAGTTT 1 142 0 ACGATTTTCC 0.933396 -33 TGCCGGCATTTCTGTTTTCATCCGTTCCGC 2 28 1 TCTGTTTTCA 0.947796 -273 ACCCTCTCTTTCGCTCTTGCTGGCTCTCTT 2 104 1 TCGCTCTTGC 0.958816 -197 GCTCTTGCTGGCTCTCTTCCTTACCGTGTT 2 116 1 GCTCTCTTCC 0.951673 -185 CTTACCGTGTTTTCTTTTGACCTTTACATC 2 135 1 TTTCTTTTGA 0.747039 -166 ACATGTCACAACTATTTTGATGTAAAGGTC 2 153 0 ACTATTTTGA 0.900136 -148 ********** Masking position 5 Map Score: 3.4349 Number of sites scoring better than the average of aligned sites = 2168 Number in coding regions = 1956 Number in noncoding regions = 212 Number of orfs with sites within 600 bp upstream = 221 Fraction of orfs with sites within 600 bp upstream = 0.0354963 Motif number 5 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0