AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i126_synecho_ctra_100.orf -o126_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY28443 110 Synechocystis Motif number 1 CTAACAAGCCTGGAAAAGTTGATTCCAGCA 1 14 0 TGGAAAAGTT 0.988795 -97 TTGTTAGGATTGGGGAGGTTGATTGAGCCT 1 37 1 TGGGGAGGTT 0.998809 -74 GACTCAATCCTGGGGAAGATGCCTAAAAAT 1 67 0 TGGGGAAGAT 0.99816 -44 GGTGATGGGAAGGAGAAAAAACCGG 1 96 0 TGGGAAGGAG 0.996866 -15 ********** Masking position 6 Map Score: 8.67313 Number of sites scoring better than the average of aligned sites = 207 Number in coding regions = 174 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 2 AATCAACCTCCCCAATCCTAACAAGCCTGG 1 31 0 CCCAATCCTA 0.995972 -80 TAAAAATAGGCTCAATCAACCTCCCCAATC 1 44 0 CTCAATCAAC 0.980517 -67 AAAAACCGGACTCAATCCTGGGGAAGATGC 1 75 0 CTCAATCCTG 0.996972 -36 CCGGTTTTTTCTCCTTCCCATCACC 1 96 1 CTCCTTCCCA 0.987994 -15 ********** Masking position 6 Map Score: 3.20285 Number of sites scoring better than the average of aligned sites = 422 Number in coding regions = 383 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 3 CCTGGAAAAGTTGATTCCAGCAAAA 1 6 0 TTGATTCCAG 0.994876 -105 GGGAGGTTGATTGAGCCTATTTTTAGGCAT 1 49 1 TTGAGCCTAT 0.983245 -62 TTCCCCAGGATTGAGTCCGGTTTTTTCTCC 1 80 1 TTGAGTCCGG 0.997714 -31 ********** Masking position 4 Map Score: 2.10338 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 56 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0