AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i309_synecho_ctra_100.orf -o309_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY27002 202 Synechocystis Motif number 1 ATCATTCGATCAATTGTGGGCTAGAT 1 5 0 CAATGTGGGT 0.998179 -198 CTCGTCGGACCAGTACTGGGCTCAATCCAGGG 1 42 1 CAGTCTGGGT 0.998822 -161 GTACTGGGCTCAATCCAGGGGTGAAGGTAAAT 1 54 1 CAATCAGGGT 0.995411 -149 TAAGCAACAACAGTAGTGGCATTGTCCGTTAT 1 170 1 CAGTGTGGCT 0.996848 -33 **** ***** * Masking position 4 Map Score: 5.47712 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 54 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 TCGATCAATTGTGGGCTAGAT 1 2 0 GTGGGCTAGA 0.944354 -201 GAGCCCAGTACTGGTCCGACGAGCTTCGAT 1 35 0 CTGGTCCGAC 0.975708 -168 CGGACCAGTACTGGGCTCAATCCAGGGGTG 1 47 1 CTGGGCTCAA 0.977484 -156 GGGCTCAATCCAGGGGTGAAGGTAAATTTC 1 59 1 CAGGGGTGAA 0.951262 -144 GGATATGGGGACAGGCTGGCCCGGGCCGGC 1 115 1 ACAGGCTGGC 0.944116 -88 ACAGGCTGGCCCGGGCCGGCGCAATTTTTT 1 125 1 CCGGGCCGGC 0.926359 -78 ********** Masking position 4 Map Score: 2.41996 Number of sites scoring better than the average of aligned sites = 2987 Number in coding regions = 2795 Number in noncoding regions = 192 Number of orfs with sites within 600 bp upstream = 218 Fraction of orfs with sites within 600 bp upstream = 0.0350145 Motif number 3 GGTAAATTTCCAGAATTCCTTCAGATTCCC 1 79 1 CAGAATTCCT 0.980228 -124 AGAATTCCTTCAGATTCCCTAATATGGATA 1 90 1 CAGATTCCCT 0.988203 -113 CAGCCTGTCCCCATATCCATATTAGGGAAT 1 103 0 CCATATCCAT 0.954744 -100 TTTTGTTAATCCAAATCTCTAAGCAACAAC 1 151 1 CCAAATCTCT 0.981568 -52 ********** Masking position 6 Map Score: 0.837072 Number of sites scoring better than the average of aligned sites = 630 Number in coding regions = 554 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 4 ********** No masking Map Score: 3.22176e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.22176e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.22176e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0