AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i345_synecho_ctra_100.orf -o345_synecho_ctra_100.ace -a/home/amcguire/genomes/ORF_synecho.txt -z/home/amcguire/genomes/synecho.fna -g0.46 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY09050 106 Synechocystis Motif number 1 TTGATCCTCTAGCCATGTTTTTATTGATAC 1 14 0 AGCCATGTTT 0.932882 -93 ATGGCTAGAGGATCAAGTTTGGTCTACTCC 1 28 1 GATCAAGTTT 0.959317 -79 GGTCTACTCCAGCCATGTTTAAGCAGAAAT 1 48 1 AGCCATGTTT 0.932882 -59 AAAAAATTTGGTCATGATTATTTTTATCT 1 88 0 GGTCATGATT 0.868852 -19 ********** Masking position 5 Map Score: 8.13488 Number of sites scoring better than the average of aligned sites = 180 Number in coding regions = 159 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 CCAAACTTGATCCTCTAGCCATGTTTTTAT 1 20 0 TCCTCTAGCC 0.99598 -87 AAGTTTGGTCTACTCCAGCCATGTTTAAGC 1 42 1 TACTCCAGCC 0.99598 -65 ********** Masking position 4 Map Score: 1.77864 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 16 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0