AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i026_ecoli_bsub_300.orf -o026_ecoli_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 frdA 294 fumarate reductase, anaerobic, flavoprotein subunit #2 sdhA 33 succinate dehydrogenase (flavoprotein subunit) #3 sdhC 292 succinate dehydrogenase (cytochrome b558 subunit) Motif number 1 AAGCACGATCTGATGGTTTAGTAATTAAATT 1 84 1 TGATGGTTAG 0.85346 -211 TTAGTGCGCAAGAGGGCTAAATTATCACTGA 1 123 0 AGAGGGTAAA 0.969689 -172 CAGTATAGTCTGATGGATAAGTCTGAAATTT 1 170 0 TGATGGTAAG 0.930497 -125 AGTACGTGGCTGTGGGATAAAAACAATCTGG 1 265 1 TGTGGGTAAA 0.858642 -30 CTAGATTACTAGAGGGAGAGGGGCTATC 2 16 1 AGAGGGGAGG 0.982272 -18 TATACGCAGGAGAGAGGGGAGACAGAT 3 7 0 AGAGAGGGAG 0.957898 -286 TATAGCTCAAACAGGGGGGAGGATTACAGAA 3 39 1 ACAGGGGGAG 0.985843 -254 GACGCCCTTTTGAGGGAGGAGTAAAATGAAA 3 180 1 TGAGGGGGAG 0.99441 -113 AATTGAAAGAAGTGGGGGAAGAGATTTAGCA 3 240 1 AGTGGGGAAG 0.986641 -53 CACTTATCAAACAGGGGGTAAAGTA 3 278 1 ACAGGGGTAA 0.897123 -15 ****** **** Masking position 6 Map Score: 12.8145 Number of sites scoring better than the average of aligned sites = 712 Number in coding regions = 598 Number in noncoding regions = 114 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 2 AGACAAATTTTACGCAGGAATCAAACAGCG 1 36 1 TACGCAGGAA 0.994847 -259 ATTTTTTTAGTGCGCAAGAGGGCTAAATTA 1 130 0 TGCGCAAGAG 0.991275 -165 AGCTATAATATACGCAGGAGAGAGGGGAGA 3 16 0 TACGCAGGAG 0.996672 -277 TATGAAAAATTAAGCAAGAAATATATATTG 3 85 1 TAAGCAAGAA 0.969248 -208 ********** Masking position 6 Map Score: 4.24112 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 43 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 ACTGCCCACCGCTGTTTGATTCCTGCGTAA 1 45 0 GCTGTTTGAT 0.989528 -250 GAAGTACGTGGCTGTGGGATAAAAACAATC 1 263 1 GCTGTGGGAT 0.950436 -32 AATCCTCCCCCCTGTTTGAGCTATAATATA 3 34 0 CCTGTTTGAG 0.993315 -259 TTTCTTGACGCCCTTTTGAGGGAGGAGTAA 3 174 1 CCCTTTTGAG 0.927672 -119 TACTTTACCCCCTGTTTGATAAGTGCGAAA 3 273 0 CCTGTTTGAT 0.992787 -20 ********** Masking position 5 Map Score: 4.15754 Number of sites scoring better than the average of aligned sites = 166 Number in coding regions = 154 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 GGGCAGTGACTAAAAAAAGCACGATCTGAT 1 68 1 TAAAAAAAGC 0.847452 -227 GTTTAGTAATTAAATTAATCATCTTCAGTG 1 99 1 TAAATTAATC 0.921061 -196 TCTTGCGCACTAAAAAAATCGATCTCGTCA 1 141 1 TAAAAAAATC 0.938245 -154 CCCCTCTCCCTCTAGTAATCTAGTACTC 2 9 0 TCTAGTAATC 0.885568 -25 AATTTTTCAATCAACTAATCAATTCGGAAA 3 124 1 TCAACTAATC 0.952953 -169 CAAAAGGGCGTCAAGAAAACGCGTACATAA 3 162 0 TCAAGAAAAC 0.922926 -131 AATGAAATTGTCAATAAATCTTAATAAAGT 3 204 1 TCAATAAATC 0.969116 -89 ********** Masking position 4 Map Score: 3.69879 Number of sites scoring better than the average of aligned sites = 205 Number in coding regions = 166 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 TTGATTCCTGCGTAAAATTTGTCTCGCCGT 1 30 0 CGTAAAATTT 0.982006 -265 AAATCGATCTCGTCAAATTTCAGACTTATC 1 156 1 CGTCAAATTT 0.960915 -139 GTAATTCTTATGAAAAATTAAGCAAGAAAT 3 77 1 TGAAAAATTA 0.944147 -216 ATTAGTTGATTGAAAAATTTTATTTTATCA 3 113 0 TGAAAAATTT 0.960352 -180 CTAATCAATTCGGAAAATTATAATTTATGT 3 138 1 CGGAAAATTA 0.969709 -155 ********** Masking position 5 Map Score: 2.67357 Number of sites scoring better than the average of aligned sites = 118 Number in coding regions = 95 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 6 GCAAGAGGGCTAAATTATCACTGAAGATGA 1 117 0 TAAATTATCA 0.970276 -178 ATCGATCTCGTCAAATTTCAGACTTATCCA 1 158 1 TCAAATTTCA 0.75086 -137 ATTTCTTGCTTAATTTTTCATAAGAATTAC 3 77 0 TAATTTTTCA 0.883839 -216 TGAAAAATTTTATTTTATCAATATATATTT 3 103 0 TATTTTATCA 0.718519 -190 AACGCGTACATAAATTATAATTTTCCGAAT 3 145 0 TAAATTATAA 0.882124 -148 GGAGTAAAATGAAATTGTCAATAAATCTTA 3 197 1 GAAATTGTCA 0.938917 -96 CCCACTTCTTTCAATTGTAAGCACTTTATT 3 226 0 TCAATTGTAA 0.858808 -67 AGCACATTTCGCACTTATCAAACAGGGGGT 3 267 1 GCACTTATCA 0.869196 -26 ********** Masking position 10 Map Score: 1.08528 Number of sites scoring better than the average of aligned sites = 525 Number in coding regions = 388 Number in noncoding regions = 137 Number of orfs with sites within 600 bp upstream = 159 Fraction of orfs with sites within 600 bp upstream = 0.0255381 Motif number 7 ********** No masking Map Score: -6.01529e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.01529e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -6.01529e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0