AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i053_ecoli_bsub_100.orf -o053_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 uxaB 226 altronate oxidoreductase #2 uxaC 300 uronate isomerase #3 yjmC 104 similar to malate dehydrogenase #4 yjmE 24 similar to D-mannonate hydrolase #5 yjmG 47 similar to hexuronate transporter #6 yjmH 87 similar to transcriptional regulator (LacI family) #7 yjmI 76 similar to tagaturonate reductase Motif number 1 ATGCAATGTGTTCTACCACTTTATGATCCAG 1 38 1 TTTACCACTT 0.97668 -189 TGCTAACCTGTCGTACCAATTCAAACAGGTT 1 179 1 TCTACCAATT 0.969847 -48 TTCTGATTAGTCATACAACCTGTTTGAATTG 1 195 0 TCTACAACCT 0.951728 -32 AGATAACTTGTCATACAACTTTAAAAGGTGA 2 56 1 TCTACAACTT 0.965146 -245 CTGCAGCGAGATTTACCACTTTGAGAGTAAT 2 157 1 ATTACCACTT 0.94991 -144 GACAAAGTTATCACACCAATTTCCAGAGTCC 2 231 0 TCCACCAATT 0.93257 -70 AACACATTTTATTTACAAATTATTTTAAATA 3 28 0 ATTACAAATT 0.636853 -77 TCAGTTTCTGTTGCACCGCTTTCG 5 4 0 TTCACCGCTT 0.927652 -44 GTATCATCAAACATACCGCCTCTCCCACTAT 6 20 0 ACTACCGCCT 0.957497 -68 CCCTTCCTTATCATACCGGCTGCGATTATTT 6 61 0 TCTACCGGCT 0.905344 -27 ** ******** Masking position 5 Map Score: 9.43684 Number of sites scoring better than the average of aligned sites = 476 Number in coding regions = 413 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 2 CAACTTTAAAAGGTGAGAGCCATCACAAAT 2 71 1 AGGTGAGAGC 0.982782 -230 AGATTTACCACTTTGAGAGTAATTTTTTTA 2 165 1 CTTTGAGAGT 0.893995 -136 CTAGCTCACTCGTTGAGAGGAAGACGAAA 2 282 1 CGTTGAGAGG 0.980969 -19 AGGGGTTTCGCTTGGAGAGTGCCCAAAAAA 3 62 1 CTTGGAGAGT 0.892082 -43 CTGAATCCGGAGGTGCGAGC 4 15 1 AGGTGCGAGC 0.946129 -10 GAACCAACATAGGGGTGAGGTTGAG 5 33 1 AGGGGTGAGG 0.956938 -15 TGGAAATATAGTGGGAGAGGCGGTATGTTT 6 13 1 GTGGGAGAGG 0.958927 -75 CGTGTGCATAAAGTGAGAGGGAGGCAATAA 7 55 1 AAGTGAGAGG 0.954392 -22 ********** Masking position 8 Map Score: 5.85629 Number of sites scoring better than the average of aligned sites = 309 Number in coding regions = 204 Number in noncoding regions = 105 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 3 AGTGGTAGAACACATTGCATTCAAATCGCGCG 1 26 0 CATTGCATTC 0.968599 -201 ATCGGCAATTTGCATTCCGTCGACTTA 2 6 1 CATTGCATTC 0.968599 -295 GACAAGTTATCTTTCTGCCGTCGCAAATCATA 2 36 0 CTCTGCCGTC 0.995339 -265 CAGTACTGGCCTTGCTGTCGTCAGGTAATGTC 2 118 0 CTCTGTCGTC 0.965158 -183 AGTGGTAAATCTCGCTGCAGGCCGCGCCAGTA 2 145 0 CTCTGCAGGC 0.974233 -156 CTAATTCCCTTCCTTATCATAC 6 76 0 CTTTCCCTTC 0.965699 -12 CCTTATTGCCTCCCTCTCACTTT 7 64 0 CTTTGCCTCC 0.981668 -13 ** ******** Masking position 6 Map Score: 3.75766 Number of sites scoring better than the average of aligned sites = 588 Number in coding regions = 566 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 4 TTAATGAGCAGTTTTATGAGAAAAGTGTGG 1 106 0 GTTTTATGAG 0.952861 -121 AACTCCTGATGATTAATGAGCAGTTTTATG 1 118 0 GATTAATGAG 0.807565 -109 ATGTGGGAATATTTGTAGGGACATTACCTG 2 99 1 ATTTGTAGGG 0.80163 -202 TTTTAACTACGTTTATTGATCTAACTCACG 2 190 1 GTTTATTGAT 0.877752 -111 AATAAAATGTGTTTGTAGGGGTTTCGCTTG 3 46 1 GTTTGTAGGG 0.968901 -59 TTCCTTTTCAGTTTTTTGGGCACTCTCCAA 3 73 0 GTTTTTTGGG 0.969498 -32 GAGGCGGTATGTTTGATGATACAATATACA 6 29 1 GTTTGATGAT 0.925509 -59 ********** Masking position 4 Map Score: 1.51573 Number of sites scoring better than the average of aligned sites = 659 Number in coding regions = 597 Number in noncoding regions = 62 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 5 AAAAACGCCTTTTCCTGGATCATAAAGTGG 1 53 0 TTTCCTGGAT 0.989641 -174 AAAAGGCGTTTTTCCTCGATTAAACCATGA 1 70 1 TTTCCTCGAT 0.972732 -157 GCTGCGATTATTTACTGTATATTGTATCAT 6 44 0 TTTACTGTAT 0.957745 -44 ACGTTAACATTTTTCTGTATAAAGAATGCC 7 28 0 TTTTCTGTAT 0.957745 -49 ********** Masking position 6 Map Score: 1.37886 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 72 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 6 ATGTGTTCTACCACTTTATGATCCAGGAAA 1 43 1 CCACTTTATG 0.988862 -184 GCGAGATTTACCACTTTGAGAGTAATTTTT 2 162 1 CCACTTTGAG 0.96681 -139 CTCAACCTCACCCCTATGTTGGTTCAGTTT 5 28 0 CCCCTATGTT 0.930417 -20 ACCGCCTCTCCCACTATATTTCCAGA 6 7 0 CCACTATATT 0.964911 -81 TGCCTCCCTCTCACTTTATGCACACGTTAA 7 51 0 TCACTTTATG 0.944484 -26 ********** Masking position 5 Map Score: 1.30618 Number of sites scoring better than the average of aligned sites = 153 Number in coding regions = 133 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 7 TTATTTTAAATATTCTTTATATTATATTG 3 10 0 TATTCTTTAT 0.895162 -95 GCAAGTGCCTCCTTCCTTTTCAGTTTTTTG 3 85 0 CCTTCCTTTT 0.969811 -20 CTAATTCCCTTCCTTATCATACCGGCT 6 71 0 CCTTCCTTAT 0.98783 -17 TTTCAGCGGGCATTCTTTATACAGAAAAAT 7 20 1 CATTCTTTAT 0.971367 -57 ********** Masking position 4 Map Score: 0.451937 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 44 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 8 ATCCAGGAAAAGGCGTTTTTCCTCGATTAAA 1 63 1 AGGCGTTTTC 0.982657 -164 ATTAATCATCAGGAGTTGATCAAAACAGGGG 1 131 1 AGGAGTTGTC 0.969817 -96 TGATCAAAACAGGGGTTCGGCGTATTAAAGT 1 147 1 AGGGGTTCGC 0.992677 -80 ATGTGTTTGTAGGGGTTTCGCTTGGAGAGTG 3 52 1 AGGGGTTTGC 0.993838 -53 ******** ** Masking position 6 Map Score: 0.225907 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 34 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 9 ********** No masking Map Score: 1.11088e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.11088e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.11088e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0