AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i085_ecoli_bsub_100.orf -o085_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 sgaT 291 orf, hypothetical protein Motif number 1 TCATGATAGTTCAATTCGAATCAATATGTGATT 1 17 1 TCAATTAACA 0.968495 -275 TCAGGATTAATCAAAACCAATCACATATTGATT 1 35 0 TCAAAAAACA 0.995719 -257 CTTTCCATACTCAAAATCAACAACAACTTCCCT 1 113 0 TCAAAAAAAA 0.972962 -179 AGTGGGATTCACACAACGAAACAATTATCCATT 1 186 0 ACACAAAACA 0.979414 -106 GCGGGTCGCGTCACATTTAATCATAAATAATCT 1 239 1 TCACATAACA 0.990407 -53 ACTCTAATTTTCAAAAGTAATCACAACAAGATT 1 267 0 TCAAAAAACA 0.995708 -25 ****** ** ** Masking position 9 Map Score: 9.00826 Number of sites scoring better than the average of aligned sites = 41 Number in coding regions = 26 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 CATATTGATTCGAATTGAACTATCATGAAG 1 15 0 CGAATTGAAC 0.945718 -277 ATGGAAAGATTTAATGGAATGTGTAATTCA 1 138 1 TTAATGGAAT 0.972846 -154 ATTCATTTAGTTAATTGAATTACACATTCC 1 153 0 TTAATTGAAT 0.987582 -139 ATTCAATTAACTAAATGAATTTAAATGGAT 1 163 1 CTAAATGAAT 0.98358 -129 CTAAATGAATTTAAATGGATAATTGTTTCG 1 173 1 TTAAATGGAT 0.96154 -119 ********** Masking position 4 Map Score: 3.69817 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 24 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 ATTTTGAGTATGGAAAGATTTAATGGAATG 1 129 1 TGGAAAGATT 0.991523 -163 AAAGATTTAATGGAATGTGTAATTCAATTA 1 142 1 TGGAATGTGT 0.986227 -150 TAATTCCACATGGATAGAGTGGGATTCACA 1 206 0 TGGATAGAGT 0.986227 -86 TCTATCCATGTGGAATTATTTGCGGGTCGC 1 218 1 TGGAATTATT 0.967145 -74 ********** Masking position 4 Map Score: 3.22819 Number of sites scoring better than the average of aligned sites = 85 Number in coding regions = 72 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 TAGTGTCAGGATTAATCAAAACCAATCACAT 1 42 0 ATTATCAAAA 0.984226 -250 TTCCCTGGCAAAAAGTCAAAAAATGGTCATT 1 88 0 AAAATCAAAA 0.9646 -204 TAAATCTTTCCATACTCAAAATCAACAACAA 1 120 0 CATATCAAAA 0.98135 -172 TCGCGTCACATTTAATCATAAATAATCTTGT 1 244 1 TTTATCATAA 0.882541 -48 TCACTCTAATTTTCAAAAGTAATCACAA 1 274 0 AATTTCAAAA 0.964573 -18 **** ****** Masking position 6 Map Score: 2.3167 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 53 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 5 TTTGATTAATCCTGACACTATTTTTTCAGG 1 53 1 CCTGACACTA 0.985542 -239 TCATTGCCTTCCTGAAAAAATAGTGTCAGG 1 63 0 CCTGAAAAAA 0.986864 -229 CAACAACTTCCCTGGCAAAAAGTCAAAAAA 1 96 0 CCTGGCAAAA 0.98986 -196 TGTGACGCGACCCGCAAATAATTCCACATG 1 224 0 CCCGCAAATA 0.973713 -68 ********** Masking position 7 Map Score: 1.67238 Number of sites scoring better than the average of aligned sites = 209 Number in coding regions = 164 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 6 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0