AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i116_ecoli_bsub_100.orf -o116_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 sapA 248 homolog of Salmonella peptide transport periplasmic protein Motif number 1 GTACGAATGTTGAACAGATGGCGACGTCAC 1 116 1 TGAACAGATG 0.988401 -133 GGTTGGTCGTTGAACAGGTGACGTCGCCAT 1 133 0 TGAACAGGTG 0.989246 -116 GTTCAGGGGTCGTAATGAGGGCCGTGTGGT 1 160 0 CGTAATGAGG 0.943472 -89 TTACCGTTTGTGTTCAGGGGTCGTAATGAG 1 171 0 TGTTCAGGGG 0.989043 -78 AGGGATTTTATGTAAAGAGGCTATCTTACT 1 222 0 TGTAAAGAGG 0.991876 -27 ********** Masking position 7 Map Score: 5.21437 Number of sites scoring better than the average of aligned sites = 235 Number in coding regions = 206 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 TAACAATGACACGCACTGCAGCGTGCTT 1 9 1 ACACGCACTG 0.981812 -240 AGAAACCCATTAAAGCACGCTGCAGTGCGT 1 21 0 TAAAGCACGC 0.925648 -228 CTCACGATCGTACCGCTCTGCTCCTCGCTA 1 49 1 TACCGCTCTG 0.918081 -200 TCTATAACTATAACTCACAGAACAACTTAG 1 76 0 TAACTCACAG 0.952814 -173 TAGTTATAGAGAAATCACGGGTACGAATGT 1 96 1 GAAATCACGG 0.944013 -153 TTCAACGACCAACCACACGGCCCTCATTAC 1 149 1 AACCACACGG 0.986093 -100 CGACCCCTGAACACAAACGGTAATGGCAAA 1 178 1 ACACAAACGG 0.901937 -71 ********** Masking position 8 Map Score: 1.8139 Number of sites scoring better than the average of aligned sites = 2782 Number in coding regions = 2622 Number in noncoding regions = 160 Number of orfs with sites within 600 bp upstream = 192 Fraction of orfs with sites within 600 bp upstream = 0.0308384 Motif number 3 GGAGCAGAGCGGTACGATCGTGAGAAACCC 1 43 0 GGTACGATCG 0.995998 -206 AGAAATCACGGGTACGAATGTTGAACAGAT 1 105 1 GGTACGAATG 0.99103 -144 ATTAAATATTAGTAAGATAGCCTCTTTACA 1 212 1 AGTAAGATAG 0.965057 -37 ********** Masking position 4 Map Score: 0.369612 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 57 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0