AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_ecoli_bsub_100.orf -o118_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 queA 92 synthesis of queuine in tRNA; probably S-adenosylmethionine:tRNA ribosyltransferase-isomerase #2 tgt 55 tRNA-guanine transglycosylase #3 yajC 22 orf, hypothetical protein #4 secD 27 protein secretion; membrane protein, part of the channel #5 secF 125 protein-export membrane protein Motif number 1 TCTAGTGCCGGGGCGCTCTCCCTGCAACCTTTA 1 36 0 GGGCGCTCCT 0.993879 -57 GAGAGCGCCCCGGCACTAGACTACCCGCCTCTT 1 49 1 CGGCACTCTA 0.997494 -44 TTCCGCGGCGCTGGTTTAAAACGTTGGA 2 6 1 CGGCGCTTTA 0.994545 -50 ACGGTGCTGATCTAGTCGAAAACG 5 2 1 CGGTGCTCTA 0.994537 -124 TAGTCGAAAACGGCGCTAAACAAACTTATGATA 5 23 1 CGGCGCTCAA 0.99786 -103 TGACCTTCTTGGTCACTTCACCAAATTTATCAG 5 98 0 GGTCACTCCA 0.97201 -28 ******* *** Masking position 7 Map Score: 8.83674 Number of sites scoring better than the average of aligned sites = 548 Number in coding regions = 522 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 2 CCGGGGCGCTCTCCCTGCAACCTTTACCCC 1 32 0 CTCCCTGCAA 0.986599 -61 GCAGGGAGAGCGCCCCGGCACTAGACTACC 1 44 1 CGCCCCGGCA 0.939306 -49 CGGCACTAGACTACCCGCCTCTTATTTTAG 1 59 1 CTACCCGCCT 0.978498 -34 TTTAAACCAGCGCCGCGGAA 2 1 0 CGCCGCGGAA 0.699466 -55 ********** Masking position 4 Map Score: 2.13551 Number of sites scoring better than the average of aligned sites = 568 Number in coding regions = 517 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 3 TAAATTTCCCTCATTATTAATA 3 10 0 ATTTCCCTCA 0.941732 -13 GGCAATTCCCTTAGGGAAAAATT 4 15 0 AATTCCCTTA 0.90339 -13 TAATCGTGACAATTGGCTCATTTGTTGTGC 5 56 0 AATTGGCTCA 0.970453 -70 AATTGTCACGATTAAGCTGAAAGACGCTGA 5 72 1 ATTAAGCTGA 0.928852 -54 ATTAAGCTGAAAGACGCTGATAAATTTGGT 5 82 1 AAGACGCTGA 0.978495 -44 GACGCTGATAAATTTGGTGAAGTGACCAAG 5 94 1 AATTTGGTGA 0.90339 -32 TGAAGTGACCAAGAAGGTCATGAAA 5 111 1 AAGAAGGTCA 0.894971 -15 ********** Masking position 1 Map Score: 1.37775 Number of sites scoring better than the average of aligned sites = 1558 Number in coding regions = 1388 Number in noncoding regions = 170 Number of orfs with sites within 600 bp upstream = 205 Fraction of orfs with sites within 600 bp upstream = 0.0329264 Motif number 4 TTATATTCTATCCAAAAGGGGGTAAAGGTT 1 14 1 TCCAAAAGGG 0.995642 -79 TTAAAATTTTTCCCTAAGGGAATTGCC 4 11 1 TCCCTAAGGG 0.981318 -17 GCTGATCTAGTCGAAAACGGCGCTAAACAA 5 16 1 TCGAAAACGG 0.988881 -110 ********** Masking position 6 Map Score: 1.3644 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0