AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_ecoli_bsub_300.orf -o118_ecoli_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 queA 92 synthesis of queuine in tRNA; probably S-adenosylmethionine:tRNA ribosyltransferase-isomerase #2 tgt 55 tRNA-guanine transglycosylase #3 yajC 22 orf, hypothetical protein #4 secD 27 protein secretion; membrane protein, part of the channel #5 secF 125 protein-export membrane protein #6 yrvB 38 yrvB #7 yrzD 115 yrzD Motif number 1 CCCTTTTGGATAGAATATAATCG 1 1 0 TAGAATATCG 0.877301 -92 AAGAGGCGGGTAGTCTAGTGCCGGGGCGCTCTC 1 49 0 TAGTAGGCCG 0.993838 -44 GACTCAGACTAAAATAAGAGGCGGGTAGTCTAG 1 64 0 AAAAAGGGCG 0.97848 -29 TCCAACGTTTTAAACCAGCGCCGCGGAA 2 6 0 TAAAAGGCCG 0.993907 -50 CGTTTTCGACTAGATCAGCACCGT 5 2 0 TAGAAGACCG 0.993907 -124 TATCATAAGTTTGTTTAGCGCCGTTTTCGACTA 5 23 0 TTGTAGGCCG 0.966561 -103 TCACTTCACCAAATTTATCAGCGTCTTTCAGCT 5 86 0 AAATATAGCG 0.803422 -40 TGAAAAACAATAAAAAAGGAGCGTGGAATTC 7 95 1 TAAAAGAGCG 0.98739 -21 **** ** **** Masking position 7 Map Score: 8.39216 Number of sites scoring better than the average of aligned sites = 400 Number in coding regions = 352 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 2 CCGGGGCGCTCTCCCTGCAACCTTTACCCC 1 32 0 CTCCCTGCAA 0.989681 -61 GCAGGGAGAGCGCCCCGGCACTAGACTACC 1 44 1 CGCCCCGGCA 0.990213 -49 CGGCACTAGACTACCCGCCTCTTATTTTAG 1 59 1 CTACCCGCCT 0.983285 -34 TTTAAACCAGCGCCGCGGAA 2 1 0 CGCCGCGGAA 0.898826 -55 TATGTATATCCTCCCTTAAACCTGTGCGAA 6 19 0 CTCCCTTAAA 0.807951 -20 TTTTACCCCCTGCCTTCTCAAACTA 7 6 1 CCCCCTGCCT 0.987449 -110 CCTTCTCAAACTACCTGGAATCATATACAA 7 23 1 CTACCTGGAA 0.966164 -93 GAATTCCACGCTCCTTTTTTATTGT 7 101 0 CCACGCTCCT 0.79788 -15 ********** Masking position 4 Map Score: 7.03465 Number of sites scoring better than the average of aligned sites = 2444 Number in coding regions = 2218 Number in noncoding regions = 226 Number of orfs with sites within 600 bp upstream = 218 Fraction of orfs with sites within 600 bp upstream = 0.0350145 Motif number 3 TTATATTCTATCCAAAAGGGGGTAAAGGTT 1 14 1 TCCAAAAGGG 0.993129 -79 TTAAAATTTTTCCCTAAGGGAATTGCC 4 11 1 TCCCTAAGGG 0.986785 -17 GCTGATCTAGTCGAAAACGGCGCTAAACAA 5 16 1 TCGAAAACGG 0.982304 -110 CAGGTTGATTCGCACAGGTTTAAGGGAGG 6 10 1 TCGCACAGGT 0.971529 -29 ********** Masking position 7 Map Score: 0.931113 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 67 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 4 AACGTTGGACTGTTTTTCTGACGTAGTGGA 2 30 1 TGTTTTTCTG 0.965898 -26 TTGGCTCATTTGTTGTGCTATCATAAGTTT 5 44 0 TGTTGTGCTA 0.943227 -82 AATTTATCAGCGTCTTTCAGCTTAATCGTG 5 78 0 CGTCTTTCAG 0.951775 -48 TATGCGTATATGTCGTCCAAGCATGACAAG 7 59 1 TGTCGTCCAA 0.962545 -57 CCTTTTTTATTGTTTTTCAAGAAGACTTGT 7 84 0 TGTTTTTCAA 0.97409 -32 ********** Masking position 6 Map Score: 0.0741986 Number of sites scoring better than the average of aligned sites = 381 Number in coding regions = 341 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 5 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0