AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i125_ecoli_bsub_100.orf -o125_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 emrA 126 multidrug resistance secretion protein Motif number 1 AGCATGTTGCGATGCTGGCCAGTCATTTTT 1 48 0 GATGCTGGCC 0.999386 -79 AGCATCGCAACATGCTGGCCTTTTTGGCAA 1 62 1 CATGCTGGCC 0.999667 -65 GCTGAGCCGACCTGCTTGCCAAAAAGGCCA 1 77 0 CCTGCTTGCC 0.998922 -50 ********** Masking position 6 Map Score: 7.73765 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 36 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TTTTTGAGCGAGATGACGCG 1 1 0 AGATGACGCG 0.989286 -126 CATGTTGCGATGCTGGCCAGTCATTTTTTC 1 46 0 TGCTGGCCAG 0.990232 -81 TCATCGGCTGAGCCGACCTGCTTGCCAAAA 1 83 0 AGCCGACCTG 0.997396 -44 AGGTCGGCTCAGCCGATGAGTTAAGAAGAT 1 94 1 AGCCGATGAG 0.99415 -33 ********** Masking position 5 Map Score: 3.08064 Number of sites scoring better than the average of aligned sites = 802 Number in coding regions = 770 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 TTTATAAATCTGGATTTTTGAGCGAGATGA 1 15 0 TGGATTTTTG 0.984466 -112 ATGCTGGCCAGTCATTTTTTCTTTTATAAA 1 37 0 GTCATTTTTT 0.977149 -90 GCAACATGCTGGCCTTTTTGGCAAGCAGGT 1 68 1 GGCCTTTTTG 0.996274 -59 ********** Masking position 5 Map Score: 0.359353 Number of sites scoring better than the average of aligned sites = 328 Number in coding regions = 241 Number in noncoding regions = 87 Number of orfs with sites within 600 bp upstream = 82 Fraction of orfs with sites within 600 bp upstream = 0.0131706 Motif number 4 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0