AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i214_ecoli_bsub_100.orf -o214_ecoli_bsub_100.ace -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.47 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.47 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 rplM 218 50S ribosomal subunit protein L13 #2 rplM 162 ribosomal protein L13 Motif number 1 CTGTCACAAATCACAAAAAGGGGTCGATCT 1 14 1 TCACAAAAAG 0.973292 -205 CTATGCCAGCACACAAAAAGTTTTGGGAAA 1 95 0 ACACAAAAAG 0.991729 -124 GTTGAGGTTCACACGACAAAGTCCGGCAAA 1 143 0 ACACGACAAA 0.965789 -76 TAAAAGCTTACCCAATAAATAGTTACACG 1 200 0 ACCCAATAAA 0.955009 -19 TATTTCAACCCCACGATAAGCCCCGGAACT 2 73 1 CCACGATAAG 0.984654 -90 CTATTTCACAACACAATAAGTTCCGGGGCT 2 91 0 ACACAATAAG 0.994213 -72 ********** Masking position 6 Map Score: 8.06532 Number of sites scoring better than the average of aligned sites = 75 Number in coding regions = 54 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 GGTCAAAGATCGACCCCTTTTTGTGATTTG 1 20 0 CGACCCCTTT 0.983061 -199 GGTCGATCTTTGACCCCGACTTCTCTATAA 1 35 1 TGACCCCGAC 0.962857 -184 TATAATCCTGCGACCCCACGTTACAAGAAA 1 60 1 CGACCCCACG 0.995922 -159 TCCGGCAAACCTACCCCTTCGAATAGCCTA 1 122 0 CTACCCCTTC 0.990324 -97 GTATGTATTTCAACCCCACGATAAGCCCCG 2 68 1 CAACCCCACG 0.984258 -95 TGAATTTCCCCTCCTAAATGATCT 2 149 0 TTTCCCCTCC 0.950558 -14 ********** Masking position 5 Map Score: 5.28008 Number of sites scoring better than the average of aligned sites = 271 Number in coding regions = 240 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 AACCTGTCACAAATCACAAAAAGGGG 1 7 1 TCACAAATCA 0.977922 -212 AAAGTTTTTTTCCCAAAACTTTTTGTGTGC 1 87 1 TCCCAAAACT 0.944284 -132 GAATAGCCTATGCCAGCACACAAAAAGTTT 1 102 0 TGCCAGCACA 0.976641 -117 TTGTTGAGGTTCACACGACAAAGTCCGGCA 1 145 0 TCACACGACA 0.965982 -74 ACGTTCTATTTCACAACACAATAAGTTCCG 2 96 0 TCACAACACA 0.98894 -67 TTATTGAAAATGACAGATCATTTAGGAGGG 2 135 1 TGACAGATCA 0.959783 -28 ********** Masking position 5 Map Score: 4.28713 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 135 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 GTTTTGGGAAAAAAACTTTCTTGTAACGTG 1 76 0 AAAAACTTTC 0.970869 -143 GCCAGCACACAAAAAGTTTTGGGAAAAAAA 1 91 0 AAAAAGTTTT 0.852943 -128 CTTACCCAATAAATAGTTACACGTTGGTGA 1 193 0 AAATAGTTAC 0.971451 -26 TAAAAGCTTACCCAATAAATA 1 208 0 AAAAGCTTAC 0.952991 -11 CGTGGGGTTGAAATACATACCATATGTTAT 2 58 0 AAATACATAC 0.893564 -105 TTCACAACACAATAAGTTCCGGGGCTTATC 2 87 0 AATAAGTTCC 0.901884 -76 ********** Masking position 8 Map Score: 1.96278 Number of sites scoring better than the average of aligned sites = 225 Number in coding regions = 177 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 5 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0