AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i053_Altronate_Metabolism_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 uxaB 226 altronate oxidoreductase #2 uxaC 300 uronate isomerase Motif number 1 CTGGATCATAAAGTGGTAGAACACATTGCATT 1 37 0 AAGTGGTAAC 0.989142 -190 TTGGTACGACAGGTTAGCAAACTTTAATACGC 1 166 0 AGGTTAGCAC 0.945334 -61 AACCTGTTTGAATTGGTACGACAGGTTAGCAA 1 178 0 AATTGGTAAC 0.89931 -49 CAATTCAAACAGGTTGTATGACTAATCAGAAG 1 195 1 AGGTTGTAAC 0.981815 -32 GTTGTATGACAAGTTATCTTTCTGCCGTCGCA 2 43 0 AAGTTATCTC 0.958101 -258 TCACCTTTTAAAGTTGTATGACAAGTTATCTT 2 55 0 AAGTTGTAAC 0.991028 -246 ATTACTCTCAAAGTGGTAAATCTCGCTGCAGG 2 156 0 AAGTGGTATC 0.966368 -145 GATGCTGACAAAGTTATCACACCAATTTCCAG 2 236 0 AAGTTATCAC 0.98595 -65 CACCATAAGCAAGCTAGCTCACTCGTTGAGAG 2 269 1 AAGCTAGCAC 0.892077 -32 ******** ** Masking position 1 Map Score: 10.2622 Number of sites scoring better than the average of aligned sites = 237 Number in coding regions = 204 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 AATGCAATGTGTTCTACCACTTTATGATCC 1 37 1 GTTCTACCAC 0.938055 -190 TTAATGAGCAGTTTTATGAGAAAAGTGTGG 1 106 0 GTTTTATGAG 0.968974 -121 AACTCCTGATGATTAATGAGCAGTTTTATG 1 118 0 GATTAATGAG 0.832831 -109 ATTCAAACAGGTTGTATGACTAATCAGAAG 1 197 1 GTTGTATGAC 0.974341 -30 GTCGACTTATGATTTGCGACGGCAGAAAGA 2 29 1 GATTTGCGAC 0.954802 -272 ACCTTTTAAAGTTGTATGACAAGTTATCTT 2 55 0 GTTGTATGAC 0.974341 -246 CCTGCAGCGAGATTTACCACTTTGAGAGTA 2 156 1 GATTTACCAC 0.966362 -145 ********** Masking position 9 Map Score: 5.55936 Number of sites scoring better than the average of aligned sites = 267 Number in coding regions = 233 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 3 ATCATAAAGTGGTAGAACACATTGCATTCA 1 35 0 GGTAGAACAC 0.969159 -192 GGTACGACAGGTTAGCAAACTTTAATACGC 1 166 0 GTTAGCAAAC 0.691209 -61 AAAGGTGAGAGCCATCACAAATGTGGGAAT 2 79 1 GCCATCACAA 0.87946 -222 ATTTTCGTGAGTTAGATCAATAAACGTAGT 2 195 0 GTTAGATCAA 0.901059 -106 TGCTGACAAAGTTATCACACCAATTTCCAG 2 236 0 GTTATCACAC 0.969599 -65 CCATAAGCAAGCTAGCTCACTCGTTGAGAG 2 271 1 GCTAGCTCAC 0.95408 -30 ********** Masking position 4 Map Score: 2.65663 Number of sites scoring better than the average of aligned sites = 372 Number in coding regions = 340 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 4 AAACCATGATCCGCGCCACACTTTTCTCAT 1 91 1 CCGCGCCACA 0.988698 -136 CTTTAATACGCCGAACCCCTGTTTTGATCA 1 147 0 CCGAACCCCT 0.932418 -80 TGCTAACCTGTCGTACCAATTCAAACAGGT 1 179 1 TCGTACCAAT 0.939443 -48 TCGCTGCAGGCCGCGCCAGTACTGGCCTTG 2 136 0 CCGCGCCAGT 0.988845 -165 GACAAAGTTATCACACCAATTTCCAGAGTC 2 232 0 TCACACCAAT 0.926059 -69 TTTGTCAGCATCGCACCATAAGCAAGCTAG 2 256 1 TCGCACCATA 0.960947 -45 ********** Masking position 6 Map Score: 1.92645 Number of sites scoring better than the average of aligned sites = 1660 Number in coding regions = 1564 Number in noncoding regions = 96 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 5 AATCATAAGTCGACGGAATGCAAATTGCCG 2 13 0 CGACGGAATG 0.963617 -288 TGATTTGCGACGGCAGAAAGATAACTTGTC 2 38 1 CGGCAGAAAG 0.994364 -263 CATTACCTGACGACAGCAAGGCCAGTACTG 2 120 1 CGACAGCAAG 0.994364 -181 CTGGCGCGGCCTGCAGCGAGATTTACCACT 2 147 1 CTGCAGCGAG 0.975778 -154 ********** Masking position 6 Map Score: 1.40891 Number of sites scoring better than the average of aligned sites = 652 Number in coding regions = 633 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 6 CCACTTTATGATCCAGGAAAAGGCGTTTTT 1 53 1 ATCCAGGAAA 0.989524 -174 TCATGGTTTAATCGAGGAAAAACGCCTTTT 1 70 0 ATCGAGGAAA 0.972727 -157 TATTGATCTAACTCACGAAAATATCTTCGG 2 203 1 ACTCACGAAA 0.972608 -98 ATATCTTCGGACTCTGGAAATTGGTGTGAT 2 223 1 ACTCTGGAAA 0.974133 -78 ********** Masking position 8 Map Score: 0.759822 Number of sites scoring better than the average of aligned sites = 260 Number in coding regions = 226 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 7 TTCTCATAAAACTGCTCATTAATCATCAGG 1 114 1 ACTGCTCATT 0.964754 -113 TTGATCAACTCCTGATGATTAATGAGCAGT 1 124 0 CCTGATGATT 0.987935 -103 AATGGGTTCCCTTCTGATTAGTCATACAA 1 208 0 CCTTCTGATT 0.988342 -19 CATTCCGTCGACTTATGATTTGCGACGGCA 2 23 1 ACTTATGATT 0.971665 -278 ********** Masking position 6 Map Score: 2.12453 Number of sites scoring better than the average of aligned sites = 146 Number in coding regions = 131 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 8 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0