AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i114_Glutamine_Transport_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 glnP 138 glutamine high-affinity transport system; membrane component Motif number 1 ACTGGCAGTTCCCTCTCCCCTATGGGGAGA 1 33 1 CCCTCTCCCC 0.999694 -106 CTCACCCTAATCCTCTCCCCATAGGGGAGA 1 46 0 TCCTCTCCCC 0.998788 -93 GGGTTTGCGCCCCTCACCCTAATCCTCTCC 1 58 0 CCCTCACCCT 0.997899 -81 GGGGCGCAAACCCGCTCCGGGGCCATTAAT 1 75 1 CCCGCTCCGG 0.99407 -64 ********** Masking position 5 Map Score: 10.3094 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 39 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 2 TAACGCTACACCTGTAAAACGC 1 3 1 ACGCTACACC 0.990599 -136 CACTGGCAGTTCCCTCTCCCCTATGGGGAG 1 32 1 TCCCTCTCCC 0.984756 -107 TGCGCCCCTCACCCTAATCCTCTCCCCATA 1 53 0 ACCCTAATCC 0.992097 -86 AGGGTGAGGGGCGCAAACCCGCTCCGGGGC 1 68 1 GCGCAAACCC 0.990964 -71 ********** Masking position 4 Map Score: 1.20247 Number of sites scoring better than the average of aligned sites = 367 Number in coding regions = 285 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 3 AGGGAACTGCCAGTGCGTTTTACAGGTGTA 1 17 0 CAGTGCGTTT 0.987082 -122 AAACCCGCTCCGGGGCCATTAATTACCCTG 1 82 1 CGGGGCCATT 0.995374 -57 TAATCAAATTCAGGGTAATTAATGGCCCCG 1 92 0 CAGGGTAATT 0.989603 -47 ********** Masking position 9 Map Score: 0.3058 Number of sites scoring better than the average of aligned sites = 278 Number in coding regions = 254 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0