AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i122_Arsenical_Resistance_Pump_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 arsR 300 transcriptional repressor of chromosomal ars operon Motif number 1 CCCTCCGCCAGCTGAAGAAATCGCTA 1 7 1 GCCAGCTGAA 0.987218 -294 GTTCTTATCTAACAGCTCAATACTATTAGC 1 59 0 AACAGCTCAA 0.981887 -242 AGCCAGAGCCACCAACTCAGGGCTGGAAAG 1 100 1 ACCAACTCAG 0.991623 -201 AAAGTAAAAAACCGACGCAAAGTCGGTTTT 1 126 1 ACCGACGCAA 0.981596 -175 CAAATGAATAGCCAACTCAAAATTCACACC 1 182 1 GCCAACTCAA 0.996486 -119 ********** Masking position 9 Map Score: 5.60578 Number of sites scoring better than the average of aligned sites = 368 Number in coding regions = 345 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 2 ACATTGCAAGAATTAGCGATTTCTTCAGCTG 1 19 0 AATTAGCGTT 0.81352 -282 CAATACTATTAGCCAGTGGCTAACATTGCAA 1 41 0 AGCCAGTGCT 0.674024 -260 TCCAGCCCTGAGTTGGTGGCTCTGGCTGGAG 1 96 0 AGTTGGTGCT 0.970018 -205 ACCGACTTTGCGTCGGTTTTTTACTTTCCAG 1 122 0 CGTCGGTTTT 0.954321 -179 ACCGACGCAAAGTCGGTTTTTTTACGTCCTG 1 136 1 AGTCGGTTTT 0.984847 -165 GTGAATTTTGAGTTGGCTATTCATTTGAAAG 1 178 0 AGTTGGCTTT 0.973239 -123 TGATTGTTGCAGGTAGTGTCTCTCTTCGAAG 1 270 0 AGGTAGTGCT 0.955849 -31 ******** ** Masking position 11 Map Score: 4.24078 Number of sites scoring better than the average of aligned sites = 859 Number in coding regions = 795 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 3 CCCTCCGCCAGCTGAAGAAATCG 1 4 1 TCCGCCAGCT 0.991426 -297 TGCAATGTTAGCCACTGGCTAATAGTATTG 1 42 1 GCCACTGGCT 0.991426 -259 AGAGTTCTTATCTAACAGCTCAATACTATT 1 62 0 TCTAACAGCT 0.904079 -239 TCCAGCCAGAGCCACCAACTCAGGGCTGGA 1 97 1 GCCACCAACT 0.993177 -204 TTCGAAGAGAGACACTACCTGCAACAATCA 1 271 1 GACACTACCT 0.948317 -30 ********** Masking position 10 Map Score: 1.8463 Number of sites scoring better than the average of aligned sites = 2171 Number in coding regions = 2097 Number in noncoding regions = 74 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 4 TGGAAAGTAAAAAACCGACGCAAAGTCGGT 1 123 1 AAAACCGACG 0.994095 -178 AGGACGTAAAAAAACCGACTTTGCGTCGGT 1 136 0 AAAACCGACT 0.995032 -165 TTTCAAATGAATAGCCAACTCAAAATTCAC 1 179 1 ATAGCCAACT 0.972224 -122 ********** Masking position 3 Map Score: 0.807304 Number of sites scoring better than the average of aligned sites = 101 Number in coding regions = 84 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 CCACCAACTCAGGGCTGGAAAGTAAAAAAC 1 108 1 AGGGCTGGAA 0.987065 -193 ATTTGAAAGGAGGTCTGAATCAGGACGTAA 1 157 0 AGGTCTGAAT 0.994777 -144 GGAAGGTAATAGGTGTGAATTTTGAGTTGG 1 193 0 AGGTGTGAAT 0.99043 -108 ********** Masking position 9 Map Score: 0.807304 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 77 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0