AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i132_Transmembrane_Transport_6_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 tbpA 163 thiamin-binding periplasmic protein #2 yabN 83 putative transport protein #3 BIME8 209 BIME #4 HI1019 300 thiamin ABC transporter, periplasmic-binding protein (tbpA) Motif number 1 TTGCTGGTTGATAACAAAATCA 1 2 1 TGCTGGTTGT 0.995232 -162 AAAATAAAATTGCTGTCTTTTGCACAGGAGT 2 54 1 TGCTGTCTTT 0.975612 -30 AGATTATACCTGCTGGTTTTTTTTATTCTCG 3 31 0 TGCTGGTTTT 0.992524 -179 AGGTATAATCTGCTGGCGGGTGATTTTACAC 3 51 1 TGCTGGCGGT 0.991714 -159 AGCGAAGTTGTGCTGGTTGCGTTGGTTAAGC 3 178 0 TGCTGGTTGG 0.987046 -32 TCGTCATTATTGCTGCCTTTTAATCATAAAT 4 268 1 TGCTGCCTTT 0.983411 -33 ********* * Masking position 4 Map Score: 8.02757 Number of sites scoring better than the average of aligned sites = 283 Number in coding regions = 261 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 CCCGTTGAGAACGGCGTTAGTGTAGTGATT 1 28 0 ACGGCGTTAG 0.962831 -136 AATCCCTTCGCCGGCGTTATCCGGATCAGG 1 98 0 CCGGCGTTAT 0.92445 -66 AGTTGACTTGCCTGCATCATGTGTGACTGA 3 88 0 CCTGCATCAT 0.968862 -122 CGGTCATCCCACTGCATCAGTCCTTCAAGC 3 128 1 ACTGCATCAG 0.985045 -82 TTTACCGCGACAGCGAAGTTGTG 3 197 0 ACCGCGACAG 0.957546 -13 CACTTGCTAATCTACGTCAGCCCCTTTATT 4 68 1 TCTACGTCAG 0.938435 -233 TACCCGTGAACCTGAAACAGTTAATACTGA 4 204 1 CCTGAAACAG 0.847594 -97 TTCCTAGTTTCCTACGTCAGTATTAACTGT 4 220 0 CCTACGTCAG 0.986192 -81 ********** Masking position 9 Map Score: 5.82912 Number of sites scoring better than the average of aligned sites = 3482 Number in coding regions = 3331 Number in noncoding regions = 151 Number of orfs with sites within 600 bp upstream = 126 Fraction of orfs with sites within 600 bp upstream = 0.0202377 Motif number 3 CTACACTAACGCCGTTCTCAACGGGGTGCCA 1 33 1 GCCGTCTCAA 0.960511 -131 TGATCCGGATAACGCCGGCGAAGGGATTTGA 1 100 1 AACGCGGCGA 0.852642 -64 TTTTATTCTCGCCGCGCTAAAAAGGGAACGT 3 11 0 GCCGCCTAAA 0.962363 -199 AGTCACACATGATGCAGGCAAGTCAACTTTC 3 90 1 GATGCGGCAA 0.975354 -120 GATGCAGTGGGATGACCGCAATTCTGAAAGT 3 115 0 GATGACGCAA 0.873277 -95 CAACTTCGCTGTCGCGGTAAA 3 199 1 GTCGCGTAAA 0.904832 -11 AAATAAAGGGGCTGACGTAGATTAGCAAGTG 4 68 0 GCTGAGTAGA 0.728692 -233 TTTTTAAAAAGCCGTTGGCAATCTTAGTAAA 4 126 1 GCCGTGGCAA 0.989331 -175 AGTTAATACTGACGTAGGAAACTAGGAATAT 4 222 1 GACGTGGAAA 0.967487 -79 ***** ***** Masking position 11 Map Score: 3.85887 Number of sites scoring better than the average of aligned sites = 4202 Number in coding regions = 4068 Number in noncoding regions = 134 Number of orfs with sites within 600 bp upstream = 134 Fraction of orfs with sites within 600 bp upstream = 0.0215226 Motif number 4 CGTGCGCTGAGAAAATACCCGTCGAACCTGA 1 72 1 GAAATACCCG 0.994778 -92 CCCGCCAGCAGATTATACCTGCTGGTTTTTT 3 40 0 GATATACCTG 0.983334 -170 CTATAAAAATGAAGATAACTCATTGTAAATT 4 30 0 GAAATAACTC 0.933304 -271 AATACGCTGAGATCATACCCGTGAACCTGAA 4 189 1 GATATACCCG 0.992534 -112 AGGAAACTAGGAATATAACCTTATCTCCTTT 4 237 1 GAAATAACCT 0.955116 -64 *** ******* Masking position 6 Map Score: 2.56307 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 81 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 CCGTTCTCAACGGGGTGCCACGCGTACGCG 1 44 1 CGGGGTGCCA 0.997258 -120 CACTCTTTTTTGAGGTGCAAA 1 153 1 TGAGGTGCAA 0.984756 -11 AAAGCCTAGTCGGGGTGCAATACGCTGAGA 4 171 1 CGGGGTGCAA 0.997909 -130 ********** Masking position 10 Map Score: 2.10233 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 6 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 TATCCGGATCAGGTTCGACGGGTATTTTCTC 1 80 0 AGGTTCGCGG 0.988008 -84 ACCCCCTTGCTTCATCGTTAGGAATTAT 2 8 1 TGCTTCACGT 0.970651 -76 CCTTCAAGCATGGTTAATCGTTGTGGGACGC 3 149 1 TGGTTAACGT 0.975737 -61 CTGGTTGCGTTGGTTAAGCGTCCCACAACGA 3 166 0 TGGTTAACGT 0.975637 -44 TACACTAGAAAGCCTAGTCGGGGTGCAATAC 4 163 1 AGCCTAGCGG 0.909313 -138 TAACTGTTTCAGGTTCACGGGTATGATCTCA 4 196 0 AGGTTCAGGG 0.958003 -105 ******* *** Masking position 5 Map Score: 1.36597 Number of sites scoring better than the average of aligned sites = 310 Number in coding regions = 289 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 7 ACCCCGTTGAGAACGGCGTTAGTGTAGTGA 1 30 0 GAACGGCGTT 0.979986 -134 ACGCCGTTCTCAACGGGGTGCCACGCGTAC 1 41 1 CAACGGGGTG 0.962633 -123 CAAATCCCTTCGCCGGCGTTATCCGGATCA 1 100 0 CGCCGGCGTT 0.984787 -64 AAAAGAGTGGCAAAGGACTTGAGAAGGAGC 1 132 0 CAAAGGACTT 0.900956 -32 CTGTCTTTTGCACAGGAGTTCCCCTTTT 2 66 1 CACAGGAGTT 0.963701 -18 CTAAGATTGCCAACGGCTTTTTAAAAAGAA 4 123 0 CAACGGCTTT 0.976139 -178 ********** Masking position 9 Map Score: 2.04913 Number of sites scoring better than the average of aligned sites = 859 Number in coding regions = 823 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 8 AAGACAGCAATTTTATTTTCCCTATATTAA 2 43 0 TTTTATTTTC 0.95473 -41 TGCTGGTTTTTTTTATTCTCGCCGCGCTAA 3 22 0 TTTTATTCTC 0.904767 -188 AATGAGTTATCTTCATTTTTATAGACTAGT 4 37 1 CTTCATTTTT 0.957924 -264 ACGTCAGCCCCTTTATTTTTTCAGAAAATG 4 81 1 CTTTATTTTT 0.95473 -220 AATAAACTTTCTACATTTTCTGAAAAAATA 4 94 0 CTACATTTTC 0.939726 -207 ********** Masking position 5 Map Score: 0.54465 Number of sites scoring better than the average of aligned sites = 275 Number in coding regions = 214 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 9 CGCGTGGCACCCCGTTGAGAACGGCGTTAG 1 38 0 CCCGTTGAGA 0.960152 -126 CGCGTACGCGTGCGCTGAGAAAATACCCGT 1 64 1 TGCGCTGAGA 0.99391 -100 CCCTTTTTAGCGCGGCGAGAATAAAAAAAA 3 16 1 CGCGGCGAGA 0.987555 -194 GAAGGACTGATGCAGTGGGATGACCGCAAT 3 124 0 TGCAGTGGGA 0.933663 -86 CGGGGTGCAATACGCTGAGATCATACCCGT 4 181 1 TACGCTGAGA 0.976234 -120 ********** Masking position 10 Map Score: 0.933284 Number of sites scoring better than the average of aligned sites = 319 Number in coding regions = 297 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 10 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 12 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0