AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i135_Transmembrane_Transport_9_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 tolB 132 periplasmic protein involved in the tonb-independent uptake of group A colicins #2 pal 34 peptidoglycan-associated lipoprotein #3 HI0381 23 peptidoglycan-associated outer membrane lipoprotein (pal) #4 HI0382 41 colicin tolerance protein (tolB) #5 HI0384 71 colicin transport protein (tolR) #6 HI0386 300 conserved hypothetical protein Motif number 1 TTGACCGTCCGAACAGTCAACATCGCGA 1 6 0 GACAGTAAAT 0.978446 -127 TTGACTGTTCGGACGGTCAACATCAGGCACCGG 1 19 1 GACGGTAAAT 0.997151 -114 TTTCTTCAAAGTGCGGTCAATTTTCCCTATATT 5 11 0 GGCGGTAATT 0.99459 -61 TGAAGAAAAAGTGCGGTAAAAATAAGTTAAAAT 5 36 1 GGCGGTAAAT 0.997639 -36 TATTTTTAAAGAACGGTTATGTTTTGAATAGAT 6 89 1 GACGGTATTT 0.969332 -212 TACTCAATGAGAAAGGTTAAAAATGATTTGTCA 6 124 1 GAAGGTAAAA 0.904069 -177 CAGGCTAAAAGTGCGGTAAAAATTTTAGATGTT 6 177 1 GGCGGTAAAT 0.997639 -124 * ***** ** ** Masking position 9 Map Score: 13.0664 Number of sites scoring better than the average of aligned sites = 214 Number in coding regions = 197 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 GGGAAAATTGACCGCACTTTGAAGAAAAAG 5 17 1 ACCGCACTTT 0.998616 -55 ACTTATTTTTACCGCACTTTTTCTTCAAAG 5 33 0 ACCGCACTTT 0.998616 -39 TCAAAACATAACCGTTCTTTAAAAATAGCC 6 86 0 ACCGTTCTTT 0.987841 -215 TAAAATTTTTACCGCACTTTTAGCCTGACT 6 174 0 ACCGCACTTT 0.998616 -127 ********** Masking position 8 Map Score: 10.9282 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 4 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 ACATTCTGCTAAATTATCGTGGGCCATCGGTC 1 94 1 AAATTTGTGG 0.988117 -39 ATAATTAATTGAATAGTAAAGGAATCATTGAA 2 13 1 GAATATAAGG 0.896711 -22 TTCTTTAGAAAAATTTATTGTTAAATTTTA 4 9 1 AAAAATATTG 0.823834 -33 ATTTATTGTTAAATTTTAAAGGTAACAAA 4 23 1 AAATTTAAGG 0.981285 -19 AAATAAGTTAAAATTTTAGAGGAATAT 5 55 1 AAATTTGAGG 0.988119 -17 TCAAGAATAAAAATACTGGTGGCTTAAGATTA 6 48 1 AAATATGTGG 0.981077 -253 AGTGCGGTAAAAATTTTAGATGTTTTAAAATG 6 186 1 AAATTTGATG 0.970158 -115 TAAAATGAATAAAATCTTATTGAGTTTTTCAT 6 211 1 AAAATTATTG 0.882372 -90 ***** * **** Masking position 3 Map Score: 7.46206 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 156 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 TAGATTTCTCCTAAATGAGTTTT 3 9 0 TTTTCCTAAA 0.90232 -15 CCGCAAAGATTGTCGCATAGAAACGCTAAAT 6 16 1 TGTGCATAGA 0.96753 -285 CACCAGTATTTTTATTCTTGATATTTAGCGT 6 38 0 TTTTTCTTGA 0.919244 -263 AACGGTTATGTTTTGAATAGATTTTACTCAA 6 100 1 TTTGAATAGA 0.887732 -201 ATTTTTAACCTTTCTCATTGAGTAAAATCTA 6 117 0 TTTTCATTGA 0.966485 -184 TCTTATTGAGTTTTTCATAGATAGCTTGCTT 6 225 1 TTTTCATAGA 0.984206 -76 CAATAAACCGTGTATTCTAGAACCAGTTTTT 6 261 0 TGTTTCTAGA 0.933888 -40 *** ******* Masking position 11 Map Score: 3.48231 Number of sites scoring better than the average of aligned sites = 146 Number in coding regions = 118 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 AGAACCCCGTGGCAACCGGTGCCTGATGTT 1 37 0 GGCAACCGGT 0.995368 -96 AATTATCGTGGGCCATCGGTCCAGATAAGG 1 105 1 GGCCATCGGT 0.995245 -28 TGTAATCTTAAGCCACCAGTATTTTTATTC 6 52 0 AGCCACCAGT 0.987491 -249 ********** Masking position 5 Map Score: 0.882582 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 100 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 6 TTTGTTACCTTTAAAATTTAACAATA 4 26 0 ACCTTTAAAA 0.962285 -16 ATATTCCTCTAAAATTTTAACTTA 5 58 0 TCCTCTAAAA 0.975284 -14 AACATAACCGTTCTTTAAAAATAGCCTCTA 6 82 0 TTCTTTAAAA 0.880371 -219 TAATGACAAATCATTTTTAACCTTTCTCAT 6 130 0 TCATTTTTAA 0.800118 -171 TCATTTTAAAACATCTAAAATTTTTACCGC 6 189 0 ACATCTAAAA 0.930807 -112 AAGATTTTATTCATTTTAAAACATCTAAAA 6 199 0 TCATTTTAAA 0.941949 -102 ********** Masking position 6 Map Score: 3.01798 Number of sites scoring better than the average of aligned sites = 148 Number in coding regions = 94 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 7 ********** No masking Map Score: -1.28365e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.28365e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.28365e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0