AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i165_Nitrate_Reductase_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 narG 300 nitrate reductase 1, alpha subunit #2 narZ 81 cryptic nitrate reductase 2, alpha subunit #3 narU 300 nitrite extrusion protein 2 Motif number 1 AACATATTAATGGCTCTTAATGAAATCCGGCGA 1 11 0 TGGCCTTAAA 0.984232 -290 TTTATGCAGATGGGTATTAAGGAGTATTCCCCA 1 49 0 TGGGATTAAA 0.99445 -252 TGTTATGTGGTGGCTGTTAATTATCCTAAAGGG 1 133 1 TGGCGTTAAA 0.971427 -168 TCAAGAGTGATGGGGATGAAAAATAAAGTAAAT 1 177 0 TGGGATGAAA 0.988746 -124 TGAAACAGCGTGGGAATTGATAACGATCAAGAG 1 203 0 TGGGATTGAA 0.976726 -98 GAGCGTTACCTTGCCCTTAAACATTAGCAATGT 1 236 1 TTGCCTTAAA 0.924861 -65 GGGGGCAGAATGGGGATTAAGTAGCCAGATATG 3 144 0 TGGGATTAAA 0.994468 -157 TAGCCAGTTATTAGAATTAAGGATGAATTGGGT 3 217 0 TTAGATTAAA 0.776321 -84 ATGCACACATTGGTAATGAAAAAAAGACAAAAC 3 266 0 TGGTATGAAA 0.931402 -35 **** ***** * Masking position 7 Map Score: 11.5936 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 202 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 TAATATGTTACCCATGGGGAATACTCCTTA 1 35 1 CCCATGGGGA 0.941995 -266 GATTTTTATGCAGATGGGTATTAAGGAGTA 1 56 0 CAGATGGGTA 0.972304 -245 GTTAATTATCCTAAAGGGGTATCTTAGGAA 1 148 1 CTAAAGGGGT 0.970927 -153 ACGATCAAGAGTGATGGGGATGAAAAATAA 1 184 0 GTGATGGGGA 0.909271 -117 GATCGTGAATCTAAAGGGTTACATATTAAC 3 38 0 CTAAAGGGTT 0.944438 -263 GATTCACGATCTGAAGGGTTGAAACATGAC 3 57 1 CTGAAGGGTT 0.972304 -244 AGCTAACCTTCAAACGGGGTTAATCTTTGA 3 93 0 CAAACGGGGT 0.937672 -208 ACCGCGGGGGCAGAATGGGGATTAAGTAGC 3 152 0 CAGAATGGGG 0.85951 -149 CTCACATGCACACATTGGTAATGAAAAAAA 3 274 0 CACATTGGTA 0.783228 -27 ********** Masking position 4 Map Score: 5.17835 Number of sites scoring better than the average of aligned sites = 847 Number in coding regions = 742 Number in noncoding regions = 105 Number of orfs with sites within 600 bp upstream = 119 Fraction of orfs with sites within 600 bp upstream = 0.0191134 Motif number 3 ATTCCCCATGGGTAACATATTAATGGCTCT 1 27 0 GGTAACATAT 0.973683 -274 TTAAGGGCAAGGTAACGCTCTGAAACAGCG 1 226 0 GGTAACGCTC 0.946339 -75 GAATCTAAAGGGTTACATATTAACTATATT 3 32 0 GGTTACATAT 0.973683 -269 TTAGCTTGTTAGTTACATTTAGTAACACAT 3 117 1 AGTTACATTT 0.925936 -184 AGTTACATTTAGTAACACATATCTGGCTAC 3 127 1 AGTAACACAT 0.951593 -174 CTGCCCCCGCGGTTACGCTTTCTTATCTAT 3 169 1 GGTTACGCTT 0.979688 -132 ********** Masking position 5 Map Score: 3.97916 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 127 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 4 TTAATAGTTTAAATAACTACAGGTATAAAACGTC 1 86 1 AAATACTCGT 0.923257 -215 AACAGCCACCACATAACAGACTGTAAATTAAGAC 1 117 0 ACATACAATT 0.908778 -184 TGATAAATCGACATTGCTAATGTTTAAGGGCAAG 1 245 0 ACATGCTAGT 0.975424 -56 GTCGCATCCGACAAGGCATCAGATCCCAATTCAT 2 37 1 ACAAGCACGT 0.972456 -45 GACATGACTCCTGCTCCAGGAATGA 2 67 0 ACATACTCGT 0.989323 -15 AAGGGTTGAAACATGACATACGTTCAAAGATTAA 3 70 1 ACATACAAGT 0.987139 -231 TGAAAAAAAGACAAAACACGAGGTAAGGCGCAAT 3 249 0 ACAAACAGGT 0.951409 -52 **** *** * * * Masking position 3 Map Score: 2.51365 Number of sites scoring better than the average of aligned sites = 161 Number in coding regions = 134 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 5 TTTATACCTGTAGTTATTTAAACTATTAAG 1 85 0 TAGTTATTTA 0.808116 -216 TCTTAATTTACAGTCTGTTATGTGGTGGCT 1 118 1 CAGTCTGTTA 0.939743 -183 GTTTGAAGGTTAGCTTGTTAGTTACATTTA 3 108 1 TAGCTTGTTA 0.955475 -193 GGGGATTAAGTAGCCAGATATGTGTTACTA 3 136 0 TAGCCAGATA 0.959811 -165 TAAGGCGCAATAGCCAGTTATTAGAATTAA 3 230 0 TAGCCAGTTA 0.979298 -71 ********** Masking position 2 Map Score: 1.02475 Number of sites scoring better than the average of aligned sites = 151 Number in coding regions = 129 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 6 TGCTCCAGGAATGAATTGGGATCTGATGCC 2 51 0 ATGAATTGGG 0.991831 -31 ACCGCGGGGGCAGAATGGGGATTAAGTAGC 3 152 0 CAGAATGGGG 0.980011 -149 AGAATTAAGGATGAATTGGGTGAAGTGCTG 3 208 0 ATGAATTGGG 0.991831 -93 ********** Masking position 5 Map Score: 0.773494 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 19 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 ********** No masking Map Score: -1.4826e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.4826e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.4826e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0