AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i187_lipoic_acid_Biosynthesis_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 lipA 208 lipoate synthesis, sulfur insertion? #2 lipB 166 protein of lipoate biosynthesis #3 HI0026 53 lipoate biosynthesis protein A (lipA) #4 HI0028 55 conserved hypothetical protein #5 HI0030 51 lipoprotein, putative #6 HI0033 53 conserved hypothetical protein #7 HI0034 124 conserved hypothetical protein Motif number 1 GAGAATGAGTAAAAGTGGGGGAAAAGTATA 2 66 0 AAAAGTGGGG 0.993827 -101 AAATAAATCAAAAAGTGCGGTCAATTTTCA 4 19 0 AAAAGTGCGG 0.998807 -37 ATTTTAGTAAAGTGCGGTAAAAAATAA 6 8 1 TAAAGTGCGG 0.994281 -46 TCCTTATCTAAAAAGTGCGGTTATTTTTTA 6 28 0 AAAAGTGCGG 0.998807 -26 TTTAGACATAAAAAGCGCGGTTAATTTCGC 7 26 1 AAAAGCGCGG 0.998229 -99 CACGCAAAAAATAAGCGCGAAATTAACCGC 7 42 0 ATAAGCGCGA 0.938176 -83 ACTTAGCAATAAAGGTGCGGAATTCTATCA 7 96 0 AAAGGTGCGG 0.996134 -29 ********** Masking position 3 Map Score: 21.009 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 66 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 CGCTTCTCCGTTACCCGGCTCCTGGTCGGG 2 13 1 TTACCCGGCT 0.984049 -154 GAGAGGGGAGTTACCCGACCAGGAGCCGGG 2 26 0 TTACCCGACC 0.965767 -141 TGATATACTTTTCCCCCACTTTTACTCATT 2 63 1 TTCCCCCACT 0.985263 -104 ATTTGAAAATTGACCGCACTTTTTGATTTA 4 16 1 TGACCGCACT 0.992274 -40 CGGTTATTTTTTACCGCACTTTACTAAAAT 6 11 0 TTACCGCACT 0.996508 -43 CGGTAAAAAATAACCGCACTTTTTAGATAA 6 25 1 TAACCGCACT 0.993505 -29 AGCGCGAAATTAACCGCGCTTTTTATGTCT 7 29 0 TAACCGCGCT 0.990377 -96 ********** Masking position 1 Map Score: 13.3829 Number of sites scoring better than the average of aligned sites = 206 Number in coding regions = 191 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 GGATTGTGCCATTTTATCGTTCTGCGCTGTG 1 33 0 ATTTTATCTT 0.989569 -176 AACGACTGGCAGTATATCATTGAAACGGACC 1 106 0 AGTATATCTT 0.898709 -103 GCGGACAAGAATTTTATCCTGATACAAAACG 2 107 0 ATTTTATCTG 0.966879 -60 TTTTTGATTTATTTTATTTTTAGGAAAGAAA 4 35 1 ATTTTATTTT 0.924845 -21 TTTCATTTTTTCTTTCTTAAAGAAA 5 5 1 ATTTTTTCTT 0.976344 -47 CTTTTCATTTATTCTTTCTTTAAGAAAGAAA 5 19 0 ATTCTTTCTT 0.971604 -33 AAGGTGCGGAATTCTATCATTGAATACCCTC 7 84 0 ATTCTATCTT 0.987445 -41 ******** ** Masking position 1 Map Score: 7.61834 Number of sites scoring better than the average of aligned sites = 92 Number in coding regions = 65 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 ATTGTGCCATTTTATCGTTCTGCGCTGTGATCTGG 1 27 0 TTTTTCTCGC 0.84957 -182 TCAATAGATTGTTGTAATTATCAACTATTTTTGAA 1 139 0 GTTTTATAAC 0.928702 -70 AACGCTTTCCTTCGTAATTCGCAACTGGAACACGC 1 179 1 TTTTTCGAAC 0.958975 -30 TCCCCCACTTTTACTCATTCTCCACGGAGATGCCG 2 74 1 TTTTTCTCAC 0.964384 -93 GGACAAGAATTTTATCCTGATACAAAACGGCATCT 2 101 0 TTTTGATCAA 0.827918 -66 AATTGGGCATTTAGTTTTTATAAAATG 3 3 0 TTTTTATAAA 0.965475 -51 AATTTGGGCATTTTTATTTAGGAAAATACT 3 34 1 TTTTTAGAAA 0.952186 -20 TTTGATTTATTTTATTTTTAGGAAAGAAA 4 37 1 TTTTTAGAAA 0.952154 -19 TTTCATTTTTTCTTTCTTAAAGAAAGAATAA 5 7 1 TTTTTCTAAA 0.968053 -45 AAGTCATCCTTATCTAAAAAGTGCGGT 6 37 0 GTTTTATTAA 0.71403 -17 ** * **** *** Masking position 8 Map Score: 3.82385 Number of sites scoring better than the average of aligned sites = 216 Number in coding regions = 146 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 81 Fraction of orfs with sites within 600 bp upstream = 0.01301 Motif number 5 AAAAGTATTGTTACAGCCAGATC 1 2 1 AAAGATTGTA 0.966231 -207 CGAAAATGTAAAATTGTTGTTGGATTGTGCCA 1 53 0 AAATGTTGTG 0.910735 -156 GACTGGCAGTATATCATTGAAACGGACCTGAA 1 102 0 ATATATTGAA 0.763757 -107 GTTAATTCAAAAATAGTTGATAATTACAACAA 1 134 1 AAATGTTGTA 0.977612 -75 TCAATTCAATAGATTGTTGTAATTATCAACTA 1 147 0 AGATGTTGAA 0.903976 -62 ATTACGAAGGAAAGCGTTTCAATTCAATAGAT 1 165 0 AAAGGTTTAA 0.946913 -44 AAAGAATTTGAAAATTGACCGC 4 1 1 AAAGATTTAA 0.90078 -55 GAATAAATGAAAAGCGTTAATATTTT 5 36 1 AAAGGTTATA 0.896878 -16 GTCTAAATTGAAATTATTTTTA 7 1 0 AAATATTTTA 0.89677 -124 **** **** ** Masking position 7 Map Score: 4.05959 Number of sites scoring better than the average of aligned sites = 388 Number in coding regions = 323 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 6 AGCCGGGTAACGGAGAAGCGAG 2 3 0 CGGAGAAGCG 0.979199 -164 TTACCCGACCAGGAGCCGGGTAACGGAGAA 2 16 0 AGGAGCCGGG 0.980149 -151 TATCACAGCGAGGAGAGGGGAGTTACCCGA 2 38 0 AGGAGAGGGG 0.983532 -129 TCATTCTCCACGGAGATGCCGTTTTGTATC 2 88 1 CGGAGATGCC 0.98304 -79 AGGCTGAAGACCGAGCTGGCGGACAAGAAT 2 126 0 CCGAGCTGGC 0.941091 -41 AGCCTGGGAGATTGGCTCGTAAGGC 2 152 0 GGGAGATTGG 0.929394 -15 ********** Masking position 4 Map Score: 1.66192 Number of sites scoring better than the average of aligned sites = 624 Number in coding regions = 564 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 7 TGTTGTTGGATTGTGCCATTTTATCGTTCT 1 41 0 TTGTGCCATT 0.956143 -168 AATGCCCAAATTGGGCATTTAGTTTTTATA 3 16 0 TTGGGCATTT 0.992038 -38 AATGCCCAATTTGGGCATTTTTATTTAGGA 3 27 1 TTGGGCATTT 0.992038 -27 ********** Masking position 2 Map Score: 0.369997 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 23 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 8 ********** No masking Map Score: -1.76682e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.76682e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.76682e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0