AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i188_Menaquinone_Biosynthesis_ecoli_hinf_reg_300.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 menD 88 2-oxoglutarate decarboxylase; SHCHC synthase #2 menF 300 isochorismate hydroxymutase 2, menaquinone biosynthesis #3 HI0282 60 conserved hypothetical protein #4 HI0285 135 menaquinone-specific isochorismate synthase (menF) #5 HI0967 25 H. influenzae predicted coding region HI0967 Motif number 1 TACAAAAATAGATTATTGATATGAATCGGTA 1 27 0 GATTATGATA 0.988107 -62 TACTTAGCCGCAATATTGATACCGGACAAAC 1 66 1 CAATATGATA 0.987822 -23 AGAGGGAAAGGAATATCGATAACCCGAATGC 2 156 0 GAATATGATA 0.993598 -145 TGAAGGGATTATTGATAGAAATAATAA 3 44 0 GATTATGATA 0.988107 -17 GCTGAATTTTCAATATTGAAAAGATTTTGTA 4 65 1 CAATATGAAA 0.952409 -71 ATCTGCGGTAGAATATGGCTAATTTTTT 4 118 1 GAATATGCTA 0.982684 -18 ****** **** Masking position 6 Map Score: 10.0418 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 40 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 CGGTATCAATATTGCGGCTAAGTATAAGGA 1 60 0 ATTGCGGCTA 0.979331 -29 CGCAATATTGATACCGGACAAACTC 1 74 1 ATACCGGACA 0.801784 -15 GCCTCACATTATACGGGGTACTACAAAAAA 2 35 0 ATACGGGGTA 0.873456 -266 GTCGCAAGAGATTCCGGCGACACCCGGCAT 2 130 1 ATTCCGGCGA 0.955743 -171 GACACCCGGCATTCGGGTTATCGATATTCC 2 148 1 ATTCGGGTTA 0.923022 -153 CTGACTGGCCAGCCAGCTCAAGGCATCAAA 2 197 0 AGCCAGCTCA 0.624248 -104 TGCCAGTAGAATTGCGGGTATGTTTGCTGA 2 223 0 ATTGCGGGTA 0.973018 -78 AAAACGGGTAATCGCGCCCAGGACGACAGC 2 275 0 ATCGCGCCCA 0.941896 -26 GGCGGACTAAAGCCCGCCTACAGAATAC 3 9 0 AGCCCGCCTA 0.960717 -52 TTTCGAGAAAAGTGCGGTTAATTTACGCTG 4 39 1 AGTGCGGTTA 0.934871 -97 AATATTGAAAATTCAGCGTAAATTAACCGC 4 52 0 ATTCAGCGTA 0.876594 -84 ********** Masking position 1 Map Score: 7.7934 Number of sites scoring better than the average of aligned sites = 1952 Number in coding regions = 1793 Number in noncoding regions = 159 Number of orfs with sites within 600 bp upstream = 138 Fraction of orfs with sites within 600 bp upstream = 0.0221651 Motif number 3 TAGCTCCTTATACTTAGCCGCAATATTGAT 1 56 1 TACTTAGCCG 0.87187 -33 AAAAAAAATGCAGTACCCCGGTGTAGGGAG 2 11 0 CAGTACCCCG 0.968536 -290 ATTTTTTTTGTAGTACCCCGTATAATGTGA 2 32 1 TAGTACCCCG 0.990103 -269 TGCAATCACTTACTACGGCGCTGGAAAATC 2 87 1 TACTACGGCG 0.986455 -214 CTGGAAAATCTACTGCGCCATTTGTCGCAA 2 107 1 TACTGCGCCA 0.974095 -194 AGGCGGGCTTTAGTCCGCCATATTTTATTA 3 20 1 TAGTCCGCCA 0.966284 -41 ATTAGCCATATTCTACCGCAGATTGTTAAT 4 111 0 TTCTACCGCA 0.847876 -25 ********** Masking position 4 Map Score: 4.10582 Number of sites scoring better than the average of aligned sites = 753 Number in coding regions = 709 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 4 AATGCAGTACCCCGGTGTAGGGAG 2 1 0 CCGTGTGGAG 0.995687 -300 ATCTACTGCGCCATTTGTCGCAAGAGATTCCGGC 2 114 1 CCTTGTGCAG 0.993497 -187 AACCCGAATGCCGGGTGTCGCCGGAATCTCTTGC 2 133 0 CCGTGTGCGG 0.99563 -168 TCATCACCATTACGTTGTTGCCAGTAGAATTGCG 2 237 0 TAGTGTGCAG 0.985479 -64 GTATTCTGTAGGCGGGCTTTAGTCC 3 2 1 TATTGTGGGG 0.957115 -59 ** * *** ** ** Masking position 8 Map Score: 1.19332 Number of sites scoring better than the average of aligned sites = 185 Number in coding regions = 173 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 GGAGCTACAAAAATAGATTATTGATATGAA 1 33 0 AAATAGATTA 0.866293 -56 CTTTGAGAGGGAAAGGAATATCGATAACCC 2 162 0 GAAAGGAATA 0.92963 -139 TGAAGGGATTATTGATAGAAA 3 50 0 GAAGGGATTA 0.960186 -11 TATTAGAAACAAAAGGATTTCACT 4 5 0 AAAAGGATTT 0.970398 -131 TTTCAATATTGAAAAGATTTTGTAAAAAAA 4 72 1 GAAAAGATTT 0.971372 -64 AAGATTTTGTAAAAAAATTTTTTGTCATTA 4 85 1 AAAAAAATTT 0.769287 -51 ********** Masking position 7 Map Score: 1.11783 Number of sites scoring better than the average of aligned sites = 269 Number in coding regions = 211 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 6 ********** No masking Map Score: 1.16772e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.16772e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.16772e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0