AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 eno 87 enolase #2 pyrG 227 CTP synthetase #3 HI0932 120 enolase (eno) Motif number 1 TAGGTTTTCCTCAAGTCACTAGTT 1 74 0 TTTTCCTCAA 0.9923 -14 AAGCGCTTGATTTGCGTCAAAAACATTTAC 2 56 1 TTTGCGTCAA 0.957553 -172 GTCAAAAACATTTACCCCAAAGGGGCTATT 2 71 1 TTTACCCCAA 0.974524 -157 GAACATGACCTGTGCCACAAACTTTCATTA 2 144 0 TGTGCCACAA 0.974976 -84 TTTTATTTTCCTCAATTAAGTTAAT 3 106 0 TTTTCCTCAA 0.9923 -15 ********** Masking position 3 Map Score: 6.65607 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 81 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 TAGAGCGGCAACGCGTACCCTGGGTACGCG 1 21 1 ACGCGTACCC 0.995955 -67 CAGACAAACAACGCGTACCCAGGGTACGCG 1 32 0 ACGCGTACCC 0.995955 -56 TCCCTCCTCTTCGCCAGCGCACTATTGAAA 2 114 0 TCGCCAGCGC 0.914112 -114 CAGGTCATGTTCGGGTATACTGCTTTCCCG 2 162 1 TCGGGTATAC 0.899131 -66 AATAACCAAGACGGGAAAGCAGTATACCCG 2 173 0 ACGGGAAAGC 0.95252 -55 CTTGTAAAAAATGCGTATGCTTTGATCTTT 3 17 0 ATGCGTATGC 0.934104 -104 TGTTTTAGGCTCGCCTAACCCGTTTTAATT 3 79 1 TCGCCTAACC 0.972539 -42 ********** Masking position 3 Map Score: 5.59062 Number of sites scoring better than the average of aligned sites = 1163 Number in coding regions = 1079 Number in noncoding regions = 84 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 3 TAGGTTTTCCTCAAGTCACTAGTTAAAC 1 70 0 TCTCAAGTCA 0.97572 -18 AATCAAGCGCTTGTCATTTAAAAAATGACAC 2 37 0 TTTCATTTAA 0.951059 -191 ATTTTCTCACTCCTGATTTCAATAGTGCGCT 2 98 1 TCTGATTTCA 0.953995 -130 GGTTATTCCATCGTCTTTTCAACCTAACTTC 2 196 1 TCTCTTTTCA 0.979787 -32 TTTTAGATTTTTTCTTGTAAAAAATGCGTA 3 30 0 TTTCTTGTAA 0.89621 -91 TTTTATTTTCCTCAATTAAGTTAATTAAA 3 102 0 TCTCAATTAA 0.968579 -19 ** ******** Masking position 4 Map Score: 2.76477 Number of sites scoring better than the average of aligned sites = 266 Number in coding regions = 200 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 4 GACACAAATGGCGCTTGACCGCGTAATTCC 2 12 0 GCGCTTGACC 0.991884 -216 TAAATGACAAGCGCTTGATTTGCGTCAAAA 2 48 1 GCGCTTGATT 0.9807 -180 CTCTTCGCCAGCGCACTATTGAAATCAGGA 2 108 0 GCGCACTATT 0.864079 -120 CAGTATACCCGAACATGACCTGTGCCACAA 2 154 0 GAACATGACC 0.854129 -74 CGTATGCTTTGATCTTTATCTAT 3 4 0 GATCTTTATC 0.905559 -117 AATCTYAAAATAGCTTTATCATATCGCCTG 3 51 1 TAGCTTTATC 0.904229 -70 ********** Masking position 8 Map Score: 0.565534 Number of sites scoring better than the average of aligned sites = 2004 Number in coding regions = 1869 Number in noncoding regions = 135 Number of orfs with sites within 600 bp upstream = 129 Fraction of orfs with sites within 600 bp upstream = 0.0207196 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0