AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i283_hypothetical8_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yrbG 209 orf, hypothetical protein #2 HI1678 300 kpsF protein (kpsF) Motif number 1 AGGTTAAATTGAGCGCCATGCTTAGAAAAT 1 34 0 GAGCGCCATG 0.98631 -176 ACAGAATATTACCCGCCGTGGTTAGCGAAA 1 80 1 ACCCGCCGTG 0.993029 -130 ATCTTCAGCGGACCGGCGAGTATACCTGAA 1 177 1 GACCGGCGAG 0.988917 -33 TGCGGTAAGAGCGCACCGTGCCGTTGGTAA 2 11 0 GCGCACCGTG 0.995709 -290 ACAGAGAGCAGACCGCCGTGTAAACGGTAA 2 52 0 GACCGCCGTG 0.997312 -249 GATAACGTCCGGGCGGCGTGAGCCGACGAC 2 89 0 GGGCGGCGTG 0.997669 -212 GAGCTACACAGGGCAGAGTGCCGGATAACG 2 112 0 GGGCAGAGTG 0.916205 -189 CCCCTATACTACGCGCCGAGTTGGTTAGAC 2 214 0 ACGCGCCGAG 0.988365 -87 ********** Masking position 4 Map Score: 18.1551 Number of sites scoring better than the average of aligned sites = 1134 Number in coding regions = 1102 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 TAAAACAAATGCCAGCTTTCGCTAACCACGG 1 95 0 GCCGCTTTCG 0.98082 -115 AAGCATCCGTTACGGCTTTCTGAAAATCTTC 1 152 1 TACGCTTTCT 0.949984 -58 GGTGCGCTCTTACCGCACCCTTTCACCCTTA 2 24 1 TACGCACCCT 0.951342 -277 TTACACGGCGGTCTGCTCTCTGTTGCACTGG 2 59 1 GTCGCTCTCT 0.990134 -242 TGCACTGGTCGTCGGCTCACGCCGCCCGGAC 2 82 1 GTCGCTCACG 0.967636 -219 CCGGACGTTATCCGGCACTCTGCCCTGTGTA 2 107 1 TCCGCACTCT 0.982971 -194 GGATTTTATTGACCGCACTAGTGATTGCCCC 2 240 0 GACGCACTAG 0.945351 -61 *** ******* Masking position 6 Map Score: 5.56571 Number of sites scoring better than the average of aligned sites = 626 Number in coding regions = 576 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 3 TTACTTTTTAGCCGCATAAAGTCAAAATTAA 1 123 1 GCGCATAAAG 0.959797 -87 TCAGCGGACCGGCGAGTATACCTGAAGAAAG 1 181 1 GCGAGTATAC 0.981179 -29 AGAGCAGACCGCCGTGTAAACGGTAAGGGTG 2 47 0 GCGTGTAAAC 0.994205 -254 GACCTAGTGGGACAAGTAAACGAGAGGAAAG 2 145 0 GCAAGTAAAC 0.970475 -156 GTCCCACTAGGTCGTATAAATACGGTTAAGG 2 163 1 GCGTATAAAT 0.950408 -138 * ********* Masking position 7 Map Score: 1.22987 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 169 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 GTATACCTGAAGAAAGGACGTTAG 1 196 1 AGAAAGGACG 0.934857 -14 GAAAGGGTGCGGTAAGAGCGCACCGTGCCG 2 18 0 GGTAAGAGCG 0.990768 -283 CCGTGTAAACGGTAAGGGTGAAAGGGTGCG 2 37 0 GGTAAGGGTG 0.987909 -264 GTAAACGAGAGGAAAGTCCGAGCTACACAG 2 131 0 GGAAAGTCCG 0.965444 -170 TATAAATACGGTTAAGGGCTTCAATAAACC 2 177 1 GTTAAGGGCT 0.939966 -124 ********** Masking position 5 Map Score: 0.812586 Number of sites scoring better than the average of aligned sites = 530 Number in coding regions = 476 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 5 TTGAGCGCCATGCTTAGAAAATCAACGCAAG 1 25 0 TGCTTAGAAA 0.98917 -185 TTACCCGCCGTGGTTAGCGAAAGCTGGCATT 1 88 1 TGGTTAGCAA 0.992974 -122 CGCGCCGAGTTGGTTAGACAATCGCTGGTTT 2 202 0 TGGTTAGAAA 0.993621 -99 ******** ** Masking position 6 Map Score: 0.204255 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 14 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 CACCCTTCGTCTTGCGTTGATTTTCTAAGCA 1 15 1 CTGCGTTGAT 0.962433 -195 CAGAATATTACCCGCCGTGGTTAGCGAAAGC 1 81 1 CCGCCGTGGT 0.968009 -129 TTAGCGAAAGCTGGCATTTGTTTTACTTTTT 1 101 1 CTGCATTTGT 0.947933 -109 AGAGCGCACCGTGCCGTTGGTAA 2 3 0 GTCCGTTGGT 0.966564 -298 TCTGCTCTCTGTTGCACTGGTCGTCGGCTCA 2 70 1 GTGCACTGGT 0.95814 -231 CTTCAATAAACCAGCGATTGTCTAACCAACT 2 195 1 CCGCGATTGT 0.951867 -106 TATACTACGCGCCGAGTTGGTTAGACAATCG 2 209 0 GCGAGTTGGT 0.959252 -92 ** ******** Masking position 8 Map Score: 0.967604 Number of sites scoring better than the average of aligned sites = 2836 Number in coding regions = 2730 Number in noncoding regions = 106 Number of orfs with sites within 600 bp upstream = 110 Fraction of orfs with sites within 600 bp upstream = 0.0176678 Motif number 8 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0