AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i342_weak3_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1263 103 homoserine acetyltransferase (met2) Motif number 1 GCCGTCTAAACGGCTAAATTATCGCACATCA 1 9 0 CGCTAAATTC 0.999227 -95 GCCGTTTAGACGGCTAAAATTTCTTGACAAGCT 1 28 1 CGCTAAATTC 0.999227 -76 ATCAGTAAGTCGATTAGCTTGTCAAGAAATTTT 1 43 0 CGTTAGCTTC 0.996533 -61 ATCAGAATGGCGTTTAAACTATCAGTAAGTCGA 1 63 0 CGTTAAATTC 0.998804 -41 ** ***** * ** Masking position 6 Map Score: 8.67238 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 14 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 CGATAATTTAGCCGTTTAGACGGCTAAAAT 1 18 1 GCCGTTTAGA 0.990536 -86 CAAGCTAATCGACTTACTGATAGTTTAAAC 1 55 1 GACTTACTGA 0.987255 -49 TAGTTTAAACGCCATTCTGATTATTACGAT 1 75 1 GCCATTCTGA 0.996858 -29 ********** Masking position 10 Map Score: 1.33418 Number of sites scoring better than the average of aligned sites = 237 Number in coding regions = 220 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TTTAAACTATCAGTAAGTCGATTAGCTTGT 1 54 0 CAGTAAGTCG 0.99665 -50 TCGTAATAATCAGAATGGCGTTTAAACTAT 1 74 0 CAGAATGGCG 0.996329 -30 ********** Masking position 5 Map Score: 0.406242 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 88 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0