AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i343_weak4_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yiaY 189 putative oxidoreductase Motif number 1 GGAAATGATTAATTAAGTTTTAAAAT 1 7 1 GATTAATTAA 0.987355 -183 AAGAATTTTGTATTAATTTATTTTAAAACT 1 26 0 TATTAATTTA 0.989492 -164 ACAAAATTCTTATGAATTTAAAAAAAGCAC 1 45 1 TATGAATTTA 0.971779 -145 AAGCACATTGTATTCATTAAACAATGTGCT 1 70 0 TATTCATTAA 0.976973 -120 CTTTTTATTAGATTAATTTTGATAATCAAT 1 97 1 GATTAATTTT 0.976662 -93 TGATCAGTATTATTGATTATCAAAATTAAT 1 108 0 TATTGATTAT 0.957876 -82 ********** Masking position 6 Map Score: 8.71427 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 56 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 2 TAATTAAGTTTTAAAATAAATTAATACAAA 1 20 1 TTAAAATAAA 0.76106 -170 TAAAATAAATTAATACAAAATTCTTATGAA 1 31 1 TAATACAAAA 0.916132 -159 TCTTATGAATTTAAAAAAAGCACATTGTTT 1 52 1 TTAAAAAAAG 0.98253 -138 ATTGTATTCATTAAACAATGTGCTTTTTTT 1 64 0 TTAAACAATG 0.973264 -126 ATTGTTTAATGAATACAATGTGCTTTTTAT 1 75 1 GAATACAATG 0.935265 -115 AAAATTAATCTAATAAAAAGCACATTGTAT 1 87 0 TAATAAAAAG 0.970735 -103 TCCTGAAAGTGTAAAAAAGGGCGGGCAGCT 1 163 0 GTAAAAAAGG 0.944598 -27 ********** Masking position 5 Map Score: 5.81614 Number of sites scoring better than the average of aligned sites = 771 Number in coding regions = 497 Number in noncoding regions = 274 Number of orfs with sites within 600 bp upstream = 287 Fraction of orfs with sites within 600 bp upstream = 0.046097 Motif number 3 TTAAATTCATAAGAATTTTGTATTAATTTA 1 36 0 AAGAATTTTG 0.960525 -154 AATTTAAAAAAAGCACATTGTTTAATGAAT 1 59 1 AAGCACATTG 0.992108 -131 ATCTAATAAAAAGCACATTGTATTCATTAA 1 80 0 AAGCACATTG 0.992108 -110 TTTTTATTAGATTAATTTTGATAATCAATA 1 98 1 ATTAATTTTG 0.811868 -92 TTTGATAATCAATAATACTGATCATATTTT 1 114 1 AATAATACTG 0.960629 -76 AAAGGGCGGGCAGCTTACTGAGGATTTTCA 1 148 0 CAGCTTACTG 0.906448 -42 ********** Masking position 9 Map Score: 5.15799 Number of sites scoring better than the average of aligned sites = 619 Number in coding regions = 543 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 4 TCATTAAACAATGTGCTTTTTTTAAATTCA 1 57 0 ATGTGCTTTT 0.995921 -133 AATGAATACAATGTGCTTTTTATTAGATTA 1 82 1 ATGTGCTTTT 0.995921 -108 ********** Masking position 4 Map Score: 2.55313 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0