AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i008_ecoli_mtub_100.orf -o008_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 uraA 85 uracil transport #2 upp 297 uracil phosphoribosyltransferase #3 upp 104 upp Motif number 1 CGACTCTTAAAGTCGGCTTTAATTATTTTT 1 16 0 AGTCGGCTTT 0.996281 -70 CGACTTTAAGAGTCGGCTTTTTTTTGAGTA 1 31 1 AGTCGGCTTT 0.996281 -55 GTCTCGCAAACGTTTGCTTTCCCTGTTAGA 2 63 0 CGTTTGCTTT 0.974268 -235 AACGTTTGCGAGACTGCTTTACACAACCTT 2 79 1 AGACTGCTTT 0.968013 -219 CCCTGGCACAAGTCTTCTTTCGCCGCGCGC 2 129 0 AGTCTTCTTT 0.982778 -169 CGGATGGAATAATCTTCTTTCATAACCATC 2 173 1 AATCTTCTTT 0.864358 -125 ATATTCTTTTCGTTGACTTTAGTCAAAATG 2 236 0 CGTTGACTTT 0.953035 -62 AGGTATAATCCGTCGATTTTTTTT 2 284 1 CGTCGATTTT 0.908319 -14 ********** Masking position 8 Map Score: 13.6119 Number of sites scoring better than the average of aligned sites = 613 Number in coding regions = 558 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 2 TGCTTGGGTCCCCACGCGTTACTTGCGGT 2 10 1 CCCCACGCGT 0.991647 -288 CACGTCTTTTCCCCAGGCGCGCGGCGAAAG 2 113 1 CCCCAGGCGC 0.99735 -185 ACTAACCTTTACCCTGGCACAAGTCTTCTT 2 140 0 ACCCTGGCAC 0.978029 -158 ACGGGGTTGACCGGTCGCGCGGATGGACGC 3 26 1 CCGGTCGCGC 0.981451 -79 GCGCGGATGGACGCACCCGTATCAGCCCCC 3 42 1 ACGCACCCGT 0.880099 -63 CTTTTAGGGGACCGAGCCACGATTGTTATA 3 71 1 ACCGAGCCAC 0.957814 -34 ********** Masking position 8 Map Score: 4.81888 Number of sites scoring better than the average of aligned sites = 1654 Number in coding regions = 1553 Number in noncoding regions = 101 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 3 AATAATTAAAGCCGACTTTAAGAGTCGGCTT 1 19 1 GCCGACTTTA 0.997171 -67 TTAGAATTGCGCCGAATTTTATTTTTCTACC 2 37 0 GCCGAATTTA 0.988856 -261 AAAGAATATTGCCGCCTTGAAGAAAGGAGGT 2 257 1 GCCGCCTTGA 0.996883 -41 ACCCGTATCAGCCCCCTTTTAGGGGACCGAG 3 56 1 GCCCCCTTTA 0.995109 -49 ********* * Masking position 7 Map Score: 4.10879 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 36 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 CGCGTTACTTGCGGTAGAAAAATAAAATTC 2 25 1 GCGGTAGAAA 0.956666 -273 AGGTTAGTTTTCGGATGGAATAATCTTCTT 2 162 1 TCGGATGGAA 0.889006 -136 GTATATGGACGGGGTTGACCGGTCGCGCGG 3 18 1 GGGGTTGACC 0.984442 -87 GACCGGTCGCGCGGATGGACGCACCCGTAT 3 34 1 GCGGATGGAC 0.987859 -71 CCCCTAAAAGGGGGCTGATACGGGTGCGTC 3 51 0 GGGGCTGATA 0.941017 -54 GGCGTTGAACCCTATATAAC 3 95 0 GGCGTTGAAC 0.969918 -10 ********** Masking position 4 Map Score: 0.87105 Number of sites scoring better than the average of aligned sites = 1275 Number in coding regions = 1198 Number in noncoding regions = 77 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 5 CGCTTTACTCAAAAAAAAGCCGACTCTTAAA 1 35 0 AAAAAAAGCC 0.892561 -51 CTTTTTTTTGAGTAAAGCGCCTATAACACAT 1 47 1 AGTAAAGGCC 0.981356 -39 TTTCCCTGTTAGAATTGCGCCGAATTTTATT 2 45 0 AGAATTGGCC 0.985619 -253 CGGCGAAAGAAGACTTGTGCCAGGGTAAAGG 2 134 1 AGACTTGGCC 0.954724 -164 GTCAACGAAAAGAATATTGCCGCCTTGAAGA 2 249 1 AGAATATGCC 0.990095 -49 AAAAAAAATCGACGGATTATACC 2 285 0 AAAAAATGAC 0.851329 -13 GCCGGGAGTATATGGACGGGGTTGACC 3 7 1 AGTATATGAC 0.922423 -98 ******* *** Masking position 1 Map Score: 4.49679 Number of sites scoring better than the average of aligned sites = 628 Number in coding regions = 538 Number in noncoding regions = 90 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 6 AAGCAGTCTCGCAAACGTTTGCTTTCCCTG 2 68 0 GCAAACGTTT 0.933566 -230 AAAAGACGTGCAAAAAGGTTGTGTAAAGCA 2 93 0 CAAAAAGGTT 0.934216 -205 CTTGTGCCAGGGTAAAGGTTAGTTTTCGGA 2 147 1 GGTAAAGGTT 0.976759 -151 AACGGTTTGAGATAAAGTTATTTTATATTC 2 204 0 GATAAAGTTA 0.906238 -94 TAGTCAAAATGATAACGGTTTGAGATAAAG 2 217 0 GATAACGGTT 0.987236 -81 ********** Masking position 5 Map Score: 0.0190889 Number of sites scoring better than the average of aligned sites = 399 Number in coding regions = 352 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 7 ********** No masking Map Score: 2.29806e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 2.29806e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 2.29806e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0