AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i104_ecoli_mtub_100.orf -o104_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yrbF 209 putative ATP-binding component of a transport system #2 Rv0167 203 hypothetical protein Rv0167 #3 Rv0586 137 hypothetical protein Rv0586 #4 Rv0654 70 hypothetical protein Rv0654 Motif number 1 CAGGTATACTCGCCGGTCCGCTGAAGATTTTCA 1 26 1 CGGGCCGCTG 0.583578 -184 ATATTACCCGCCGTGGTTAGCGAAAGCTGGCAT 1 113 0 CCGGTAGCGA 0.948191 -97 CGTTTGCCCGCTATTGACGAAGG 2 1 1 CGTGCCGCTA 0.964856 -203 GGAATCTACCCGATGGCCAGCCAGGAGTGTAAG 2 51 0 CGGGCAGCCA 0.971705 -153 CGGGTAGATTCCTGTGGTCTCCGTTACTCCCTG 2 72 1 CCTGTCTCCG 0.860061 -132 CGACCCTTGGTGTGTGACCGCCACCTCGTTACT 2 107 0 TGTGCCGCCA 0.894331 -97 CGGTCACACACCAAGGGTCGGGGCAAGGAGGAG 2 120 1 CCGGTCGGGG 0.925523 -84 ACCTGGGTATCGCGGCGCCGCGGCGCATCATGT 2 160 0 CGGCCCGCGG 0.970304 -44 CGCCGCGATACCCAGGTCGGCGGCTTGAGGGAG 2 176 1 CCGGCGGCGG 0.765804 -28 ATCTTCCGAATCAGGGCCCGCGGTGTCTGGTGC 3 20 1 TCGGCCGCGG 0.88315 -118 GGTGCCGTTTCGCGGCTCCGCGGACAACTTAGC 3 48 1 CGGCCCGCGG 0.970304 -90 CCGATAACTGCGTGGGGTGTCGGTCTGACCACT 3 81 1 CGGGTGTCGG 0.959248 -57 ** ** ****** Masking position 11 Map Score: 21.7365 Number of sites scoring better than the average of aligned sites = 2486 Number in coding regions = 2411 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 2 AAATCTTCAGCGGACCGGCGAGTATACCTG 1 26 0 CGGACCGGCG 0.981758 -184 GTTACTCACAGGGAGTAACGGAGACCACAG 2 83 0 GGGAGTAACG 0.968768 -121 GTTACTCCCTGTGAGTAACGAGGTGGCGGT 2 94 1 GTGAGTAACG 0.842827 -110 CACCAAGGGTCGGGGCAAGGAGGAGGCGTG 2 128 1 CGGGGCAAGG 0.939879 -76 CTGGGTATCGCGGCGCCGCGGCGCATCATG 2 161 0 CGGCGCCGCG 0.736676 -43 GGCGGCTTGAGGGAGCCGCG 2 194 1 GGGAGCCGCG 0.996281 -10 CTTCCGAATCAGGGCCCGCGGTGTCTGGTG 3 22 1 AGGGCCCGCG 0.923281 -116 AAGTTGTCCGCGGAGCCGCGAAACGGCACC 3 48 0 CGGAGCCGCG 0.954301 -90 AGCCCGATAACTGCGTGGGGTGTCGGTCTG 3 78 1 CTGCGTGGGG 0.814936 -60 TTCTCACCAAGGGCGTACCGTTCCAATATC 4 21 1 GGGCGTACCG 0.945863 -50 ********** Masking position 3 Map Score: 13.6361 Number of sites scoring better than the average of aligned sites = 2818 Number in coding regions = 2687 Number in noncoding regions = 131 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 3 GAGTATACCTGAAGAAAGGACGTTAG 1 7 0 GAAGAAAGGA 0.70283 -203 TTTCGCTAACCACGGCGGGTAATATTCTGT 1 121 1 CACGGCGGGT 0.989671 -89 ATCAACGCAAGACGAAGGGTGAATT 1 195 1 GACGAAGGGT 0.994245 -15 GCCCGCTATTGACGAAGGGTTAAATGTGCG 2 16 1 GACGAAGGGT 0.994245 -188 GAGTAACGGAGACCACAGGAATCTACCCGA 2 71 0 GACCACAGGA 0.954035 -133 GGCGGTCACACACCAAGGGTCGGGGCAAGG 2 118 1 CACCAAGGGT 0.994244 -86 CGGCACCAGACACCGCGGGCCCTGATTCGG 3 25 0 CACCGCGGGC 0.981753 -113 GCCATGTTCTCACCAAGGGCGTACCGTTCC 4 15 1 CACCAAGGGC 0.993036 -56 ********** Masking position 2 Map Score: 14.4028 Number of sites scoring better than the average of aligned sites = 325 Number in coding regions = 310 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 4 TTCAGCGGACCGGCGAGTATACCTGAAGAA 1 21 0 CGGCGAGTAT 0.895732 -189 TCGCTAACCACGGCGGGTAATATTCTGTAA 1 123 1 CGGCGGGTAA 0.993954 -87 CAACGCAAGACGAAGGGTGAATT 1 197 1 CGAAGGGTGA 0.978189 -13 CCGCTATTGACGAAGGGTTAAATGTGCGGA 2 18 1 CGAAGGGTTA 0.918621 -186 ATGGCCAGCCAGGAGTGTAAGGCATCCGCA 2 42 0 AGGAGTGTAA 0.957389 -162 CCCCGACCCTTGGTGTGTGACCGCCACCTC 2 113 0 TGGTGTGTGA 0.88801 -91 GGCAAGGAGGAGGCGTGCGACATGATGCGC 2 141 1 AGGCGTGCGA 0.944724 -63 ********** Masking position 5 Map Score: 2.23039 Number of sites scoring better than the average of aligned sites = 1141 Number in coding regions = 1046 Number in noncoding regions = 95 Number of orfs with sites within 600 bp upstream = 94 Fraction of orfs with sites within 600 bp upstream = 0.015098 Motif number 5 ACGGCTTTCTGAAAATCTTCAGCGGACCGG 1 38 0 GAAAATCTTC 0.630042 -172 GTTCTAACGATCTTCCGAATCAGGG 3 6 1 AACGATCTTC 0.920905 -132 TTGACGTCTTACCAATCTTCATTCACACTG 3 113 1 ACCAATCTTC 0.982363 -25 GCCGATCTCCTATAACATTG 4 61 0 GCCGATCTCC 0.968645 -10 ********** Masking position 5 Map Score: 0.479127 Number of sites scoring better than the average of aligned sites = 174 Number in coding regions = 169 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 TTAGCGAAAGCTGGCATTTGTTTTACTTTT 1 100 0 CTGGCATTTG 0.895144 -110 TCGTCAATAGCGGGCAAACG 2 1 0 CGGGCAAACG 0.988236 -203 ACACTCCTGGCTGGCCATCGGGTAGATTCC 2 54 1 CTGGCCATCG 0.994234 -150 CACCAAGGGTCGGGGCAAGGAGGAGGCGTG 2 128 1 CGGGGCAAGG 0.970751 -76 AGCCGCCGACCTGGGTATCGCGGCGCCGCG 2 171 0 CTGGGTATCG 0.977495 -33 ********** Masking position 4 Map Score: 1.43294 Number of sites scoring better than the average of aligned sites = 634 Number in coding regions = 609 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 7 GCTTAATTTTGACTTTATGCGGCTAAAAAGTAA 1 75 1 GACTAGCGGC 0.997597 -135 GGAGGCGTGCGACATGATGCGCCGCGGCGCCGC 2 149 1 GACTAGCGCC 0.99157 -55 CGCGGCTCCCTCAAGCCGCCGACCTGGGT 2 185 0 TCCTAGCCGC 0.96663 -19 GACACCGCGGGCCCTGATTCGGAAGATCGTTAG 3 14 0 GCCTATCGGA 0.958453 -124 GGTGTCTGGTGCCGTTTCGCGGCTCCGCGGACA 3 41 1 GCCTTGCGGC 0.62436 -97 AGATTGGTAAGACGTCAAGTGGTCAGACCGACA 3 98 0 GACTAGTGGT 0.938686 -40 *** * * ***** Masking position 5 Map Score: 2.98294 Number of sites scoring better than the average of aligned sites = 603 Number in coding regions = 563 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 8 ********** No masking Map Score: -9.14168e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -9.14168e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -9.14168e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0