AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i108_ecoli_mtub_100.orf -o108_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 Rv1219c 141 hypothetical protein Rv1219c Motif number 1 GACGCAAAATCGCCCTGAACCGTGCGTTCCAG 1 22 1 CGCCTGACCG 0.999058 -120 GACGCAAAATCGCCCTGGAACGCACGGTTCAG 1 36 0 CGCCTGAACG 0.980421 -106 GTGAAGGCCGCGAACTTTGCCGAGCAGACGCA 1 62 0 CGACTTGCCG 0.994492 -80 GCAAAGTTCGCGGCCTTCACGGATTCCCAACG 1 74 1 CGCCTTACGG 0.998369 -68 CAACGGCGCCCTCCCTTGACCGGGGATGAACG 1 101 1 CTCCTTACCG 0.997752 -41 ** **** **** Masking position 6 Map Score: 13.4941 Number of sites scoring better than the average of aligned sites = 145 Number in coding regions = 141 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 TTCGGCGAGCAGACGCAAAATCGCCC 1 7 1 GAGCAGACGC 0.997203 -135 AATCGCCCTGGAACGCACGGTTCAGGGCGA 1 31 0 GAACGCACGG 0.977466 -111 GAACTTTGCCGAGCAGACGCAAAATCGCCC 1 53 0 GAGCAGACGC 0.997203 -89 GGGCGCCGTTGGGAATCCGTGAAGGCCGCG 1 82 0 GGGAATCCGT 0.935814 -60 CCCCGGTCAAGGGAGGGCGCCGTTGGGAAT 1 96 0 GGGAGGGCGC 0.98828 -46 GACCGGGGATGAACGTACGTTTAATATCCT 1 118 1 GAACGTACGT 0.983976 -24 ********** Masking position 8 Map Score: 8.38103 Number of sites scoring better than the average of aligned sites = 1561 Number in coding regions = 1502 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 3 CGATTTTGCGTCTGCTCGCCGAA 1 4 0 TCTGCTCGCC 0.997398 -138 CGAGCAGACGCAAAATCGCCCTGAACCGTG 1 16 1 CAAAATCGCC 0.993846 -126 CGAGCAGACGCAAAATCGCCCTGGAACGCA 1 44 0 CAAAATCGCC 0.993846 -98 CGATTTTGCGTCTGCTCGGCAAAGTTCGCG 1 56 1 TCTGCTCGGC 0.992866 -86 ********** Masking position 6 Map Score: 4.80137 Number of sites scoring better than the average of aligned sites = 964 Number in coding regions = 935 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0