AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i218_ecoli_mtub_300.orf -o218_ecoli_mtub_300.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 rpmB 216 50S ribosomal subunit protein L28 #2 radC 93 DNA repair protein #3 rpmB2 112 rpmB2 Motif number 1 CCCGCTATGCGCGATCCTTCGG 1 2 1 CGCTATGCGC 0.993101 -215 TACGCTGACTCAGCGATGTGCTCAAGTCCCG 1 47 0 CGCGATGTGC 0.994772 -170 GAACTCTCGATTGCCAGGCCCAAATGCCAAA 1 105 0 TGCCAGGCCC 0.982475 -112 TCACATAGAACTGCGATGACCGGGCTGTAAA 1 134 1 CGCGATGACC 0.990773 -83 CTGTAAAGCCTGACGAGGCGCCAATACCCCA 1 158 1 TACGAGGCGC 0.966485 -59 GAGATTCACTTTGCGAGGCGCTTTCCAGGAT 2 13 1 TGCGAGGCGC 0.996629 -81 TTTAACGAAACGGCTATGACAGGATGCGAGC 2 61 1 CGCTATGACA 0.844763 -33 GTTTTCATTATTGCGACGTCGACGGTACAGT 3 31 1 TGCGACGTCG 0.923313 -82 TTTTCGACAACAGCTAGGTGGCACTGTACCG 3 53 0 CGCTAGGTGG 0.976377 -60 * ********* Masking position 6 Map Score: 13.1599 Number of sites scoring better than the average of aligned sites = 1945 Number in coding regions = 1854 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 2 CAGACAAAGATCCCGAAGGATCGCGCATAGCGGG 1 10 0 TCGGGATCCG 0.987157 -207 TACTACGCCACCTTTGAGAATCTCGGGTTTGGCAT 1 78 1 CCTGAATCCG 0.995265 -139 GCGCCAATACCCCATACGAAGCTCGAGCTAATTTG 1 175 1 CCTGAAGCCG 0.998394 -42 CTCCTTTGTGGTGCTCGCATCCTGTCA 2 77 0 CCTGGTGCCG 0.995873 -17 AAAACTGTTATCGATAAGGAGGACG 3 1 0 TCTGGAGGCG 0.993038 -112 GGGGCACCCTTCCTTCGAAGCTCGGCTTATTGAA 3 89 0 TTTGAAGCCG 0.983924 -24 ** * ***** ** Masking position 8 Map Score: 6.18597 Number of sites scoring better than the average of aligned sites = 239 Number in coding regions = 224 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 TCCCGAAGGATCGCGCATAGCGGG 1 4 0 TCCGCATAGC 0.863433 -213 TCAGCGATGTGCTCAAGTCCCGAACAGACAA 1 38 0 GCCAAGTCCC 0.978233 -179 CGATTGCCAGGCCCAAATGCCAAACCCGAGA 1 98 0 GCCAAATGCC 0.985617 -119 CTATGTGAACTCTCGATTGCCAGGCCCAAAT 1 111 0 TCCGATTGCC 0.957587 -106 GCCTGACGAGGCGCCAATACCCCATACGAAG 1 165 1 GCCCAATACC 0.985617 -52 CCTTTGTGGTGCTCGCATCCTGTCATAGCCG 2 71 0 GCCGCATCCT 0.986684 -23 GGGGCACCCTTCCTTCGAAGCTCG 3 99 0 GCCCCTTCCT 0.96462 -14 ** ******** Masking position 8 Map Score: 3.49444 Number of sites scoring better than the average of aligned sites = 1328 Number in coding regions = 1233 Number in noncoding regions = 95 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 4 CGCTTTCCAGGATTGAAAACTGGCCGTCGA 2 31 1 GATTGAAAAC 0.975392 -63 CGTCCTCCTTATCGATAACAGTTTTCATT 3 10 1 TATCGATAAC 0.966996 -103 GACGTCGCAATAATGAAAACTGTTATCGAT 3 21 0 TAATGAAAAC 0.964464 -92 ACCTAGCTGTTGTCGAAAATGATTTTCAAT 3 65 1 TGTCGAAAAT 0.950674 -48 AAGCTCGGCTTATTGAAAATCATTTTCGAC 3 76 0 TATTGAAAAT 0.975386 -37 ********** Masking position 6 Map Score: 2.81112 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 273 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 ACCTTTGAGAATCTCGGGTTTGGCATTTGG 1 87 1 ATCTCGGGTT 0.907839 -130 GGGCCTGGCAATCGAGAGTTCACATAGAAC 1 115 1 ATCGAGAGTT 0.922122 -102 CCCCATACGAAGCTCGAGCTAATTTGATTT 1 184 1 AGCTCGAGCT 0.499923 -33 CTTCCTTCGAAGCTCGGCTTATTGAAAATC 3 85 0 AGCTCGGCTT 0.960059 -28 ********** Masking position 1 Map Score: 0.710255 Number of sites scoring better than the average of aligned sites = 121 Number in coding regions = 110 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 6 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0