AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i226_ecoli_mtub_100.orf -o226_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 glyQ 300 glycine tRNA synthetase, alpha subunit Motif number 1 ATCCTTGCATAACGCTTCCATATTCAACGAA 1 24 0 AACGCTTCCT 0.991954 -277 CGCGCATTTCATAGCTTCCCTGGAACTGTTC 1 109 0 ATAGCTTCCT 0.997388 -192 ATGCGCGGTTATACCTTCCGTAAAGAGCAGT 1 133 1 ATACCTTCCT 0.997399 -168 TTCGTACTGTATATCTTCCATCCAGCGGGTA 1 234 1 ATATCTTCCT 0.992933 -67 GGGTATACTGATCCCTTCCTTTAAATCCACA 1 260 1 ATCCCTTCCT 0.997589 -41 ********* * Masking position 6 Map Score: 11.5188 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 42 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 GAATATGGAAGCGTTATGCAAGGATCAGGC 1 30 1 GCGTTATGCA 0.983501 -271 CGGTGTTATAACGTTTTGCCGCCTGATCCT 1 50 0 ACGTTTTGCC 0.993764 -251 GGTGACGTCGATTTTTTGCTCGCCGGTGTT 1 73 0 ATTTTTTGCT 0.896055 -228 GCGGATGGCCATTTTTTGCATCTTTCCATG 1 181 1 ATTTTTTGCA 0.938275 -120 ATCTTTCCATGCGTTAAGCCCTGCTTTTTC 1 200 1 GCGTTAAGCC 0.970096 -101 GTTAAGCCCTGCTTTTTCCCGTTTCGTACT 1 212 1 GCTTTTTCCC 0.973361 -89 ********** Masking position 5 Map Score: 4.88962 Number of sites scoring better than the average of aligned sites = 1737 Number in coding regions = 1597 Number in noncoding regions = 140 Number of orfs with sites within 600 bp upstream = 158 Fraction of orfs with sites within 600 bp upstream = 0.0253774 Motif number 3 ATTCAACGAACGCAGAGGATCAA 1 4 0 CGCAGAGGAT 0.979162 -297 TTTCCCGTTTCGTACTGTATATCTTCCATC 1 226 1 CGTACTGTAT 0.981056 -75 GATCAGTATACCCGCTGGATGGAAGATATA 1 243 0 CCCGCTGGAT 0.994584 -58 ATTATTTCGTGCTGGATACGTGTGGAT 1 284 0 CGTGCTGGAT 0.996868 -17 ********** Masking position 9 Map Score: 2.78338 Number of sites scoring better than the average of aligned sites = 777 Number in coding regions = 747 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 CGTCACCGCCTTCGAACAGTTCCAGGGAAG 1 96 1 TTCGAACAGT 0.98418 -205 TTTTTCCCGTTTCGTACTGTATATCTTCCA 1 224 1 TTCGTACTGT 0.994754 -77 ATTATTTCGTGCTGGATACGTGTGG 1 286 0 TTCGTGCTGG 0.992728 -15 ********** Masking position 2 Map Score: 1.24351 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 44 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 CAAGGATCAGGCGGCAAAACGTTATAACAC 1 48 1 GCGGCAAAAC 0.992633 -253 TATGAAATGCGCGGTTATACCTTCCGTAAA 1 127 1 GCGGTTATAC 0.99647 -174 CTTCCATCCAGCGGGTATACTGATCCCTTC 1 248 1 GCGGGTATAC 0.99762 -53 ********** Masking position 7 Map Score: 2.6404 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 21 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 TGGAAGCGTTATGCAAGGATCAGGCGGCAA 1 35 1 ATGCAAGGAT 0.972917 -266 AAGCTATGAAATGCGCGGTTATACCTTCCG 1 123 1 ATGCGCGGTT 0.9593 -178 ACTGCTCTTTACGGAAGGTATAACCGCGCA 1 134 0 ACGGAAGGTA 0.948882 -167 GCAGGGCTTAACGCATGGAAAGATGCAAAA 1 194 0 ACGCATGGAA 0.985842 -107 CGTGCTGGATACGTGTGGATTTAAAGGAAG 1 274 0 ACGTGTGGAT 0.96506 -27 ********** Masking position 1 Map Score: 1.52547 Number of sites scoring better than the average of aligned sites = 570 Number in coding regions = 539 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0