AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i253_ecoli_mtub_100.orf -o253_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 motA 126 proton conductor component of motor; no effect on switching Motif number 1 GGTACGTCGTTACCGCTGCTGGAATGTTGC 1 26 0 TACCGCTGCT 0.994918 -101 GGTAACGACGTACCGCTGCTTTTTTTTGCC 1 42 1 TACCGCTGCT 0.994918 -85 GACATCATCCTTCCACTGTTGACCATGACA 1 107 0 TTCCACTGTT 0.992707 -20 ********** Masking position 7 Map Score: 6.90797 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 41 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 TGTTGCGCCTCACCGTATCAG 1 2 0 CACCGTATCA 0.989437 -125 CGGTGAGGCGCAACATTCCAGCAGCGGTAA 1 17 1 CAACATTCCA 0.989211 -110 GCAGCGGTAACGACGTACCGCTGCTTTTTT 1 37 1 CGACGTACCG 0.978805 -90 GACGACTGAACATCCTGTCATGGTCAACAG 1 92 1 CATCCTGTCA 0.989367 -35 GACATCATCCTTCCACTGTTGACCA 1 112 0 CATCCTTCCA 0.996034 -15 ********** Masking position 6 Map Score: 5.15496 Number of sites scoring better than the average of aligned sites = 547 Number in coding regions = 515 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 TGGAATGTTGCGCCTCACCGTATCAG 1 7 0 CGCCTCACCG 0.997582 -120 GCAGCGGTACGTCGTTACCGCTGCTGGAAT 1 31 0 GTCGTTACCG 0.995956 -96 GCCCCAATCGCGCGTTAACGCCTGACGACT 1 69 1 CGCGTTAACG 0.997149 -58 ********** Masking position 7 Map Score: 2.84838 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 251 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0