AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i265_ecoli_mtub_100.orf -o265_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ybgC 149 orf, hypothetical protein Motif number 1 TCTCTTTAAAAAATTATGGGCCGCTCCAGGC 1 19 1 AATTATGGGC 0.997479 -131 GGAGCGTAAAAATTTATGGGCCTGGAGCGGC 1 38 0 AATTATGGGC 0.997479 -112 GAATGAGGGCAAGTTAAGGGAGCGTAAAAAT 1 56 0 AATTAAGGGA 0.991907 -94 GCGCGCGATTGAGGTTTGGGAATGAGGGCAA 1 75 0 GAGTTTGGGA 0.983499 -75 TAATGCAACAAAAGTTAGAGCTTTTAAACGC 1 117 0 AAGTTAGAGC 0.975529 -33 ** ******** Masking position 5 Map Score: 7.20434 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 124 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 2 GGCCGCTCCAGGCCCATAAATTTTTACGCT 1 37 1 GGCCCATAAA 0.977953 -113 GCAAGTTAAGGGAGCGTAAAAATTTATGGG 1 49 0 GGAGCGTAAA 0.996378 -101 TGGGAATGAGGGCAAGTTAAGGGAGCGTAA 1 60 0 GGCAAGTTAA 0.954307 -90 ACCTCAATCGCGCGCGTATAGTAGCAGCGT 1 91 1 CGCGCGTATA 0.991934 -59 GCGTATAGTAGCAGCGTTTAAAAGCTCTAA 1 104 1 GCAGCGTTTA 0.974391 -46 ********** Masking position 7 Map Score: 3.45379 Number of sites scoring better than the average of aligned sites = 1812 Number in coding regions = 1679 Number in noncoding regions = 133 Number of orfs with sites within 600 bp upstream = 149 Fraction of orfs with sites within 600 bp upstream = 0.0239319 Motif number 3 CTTAACTTGCCCTCATTCCCAAACCTCAAT 1 69 1 CCTCATTCCC 0.998248 -81 CATTCCCAAACCTCAATCGCGCGCGTATAG 1 82 1 CCTCAATCGC 0.99822 -68 ********** Masking position 5 Map Score: 0.988104 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0