AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i273_ecoli_mtub_100.orf -o273_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yjgP 266 orf, hypothetical protein Motif number 1 CCGCCGTTGTCTTTAAGATTCAGGAGCGTA 1 15 0 CTTTAAGATT 0.990686 -252 GCCGTAATAACGTTAAGATTAACACGAAGT 1 97 0 CGTTAAGATT 0.993959 -170 ACGGATTCACCTCTCAGATTTTGTTCTGAC 1 135 0 CTCTCAGATT 0.989745 -132 TCGAAATCGTCGCTAAGATAATTATACTCA 1 165 0 CGCTAAGATA 0.99017 -102 ********** Masking position 6 Map Score: 5.54356 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 29 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 TTAAAGACAACGGCGGTGGCTACAGATAGA 1 29 1 CGGCGGTGGC 0.998655 -238 TAACTCATGTCCGCTGTTGCGATGACTTCG 1 73 1 CCGCTGTTGC 0.995327 -194 AACGTTATTACGGCATTGGCACGTCAGAAC 1 113 1 CGGCATTGGC 0.996921 -154 CGTAAAAACTCGTCTTTTGCAGGATTTTAG 1 235 0 CGTCTTTTGC 0.989351 -32 ********** Masking position 7 Map Score: 5.39094 Number of sites scoring better than the average of aligned sites = 467 Number in coding regions = 449 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 AATTCTATCTGTAGCCACCGCCGTTGTCTTT 1 31 0 GTACCACCGC 0.970185 -236 CAAGCTTTCGTAACTCATGTCCGCTGTTGCG 1 63 1 TAATCATGTC 0.941851 -204 AGATTAACACGAAGTCATCGCAACAGCGGAC 1 81 0 GAATCATCGC 0.995754 -186 TATACTCAACGGATTCACCTCTCAGATTTTG 1 142 0 GGATCACCTC 0.987895 -125 TTGAGTCGTCGAAATCGTCGCTAAGATAATT 1 172 0 GAATCGTCGC 0.989774 -95 GATTTTAGCTTGTTTCATGGCTTAAACGTCA 1 212 0 TGTTCATGGC 0.927376 -55 *** ******* Masking position 6 Map Score: 3.08791 Number of sites scoring better than the average of aligned sites = 1252 Number in coding regions = 1191 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 4 TAATCTTAACGTTATTACGGCATTGGCACG 1 106 1 GTTATTACGG 0.994332 -161 CTCAGATTTTGTTCTGACGTGCCAATGCCG 1 123 0 GTTCTGACGT 0.987672 -144 CAAAAGACGAGTTTTTACGGGCGTATTTAA 1 246 1 GTTTTTACGG 0.994331 -21 ********** Masking position 7 Map Score: 1.75909 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 68 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0