AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i338_ecoli_mtub_300.orf -o338_ecoli_mtub_300.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 bioB 86 biotin synthesis, sulfur insertion? Motif number 1 AATCTTTTCAATTTGGTTTACAAGTCGATT 1 11 0 ATTTGGTTTA 0.992751 -76 ATTGAAAAGATTTAGGTTTACAAGTCTACA 1 29 1 TTTAGGTTTA 0.987273 -58 TTTGTTGTTAATTCGGTGTAGACTTGTAAA 1 45 0 ATTCGGTGTA 0.994506 -42 AAAACGTGTTTTTTGTTGTTAATTCGGTGT 1 56 0 TTTTGTTGTT 0.962624 -31 AAAAAACACGTTTTGGAGAAGCCCC 1 72 1 TTTTGGAGAA 0.975878 -15 ********** Masking position 3 Map Score: 7.34427 Number of sites scoring better than the average of aligned sites = 457 Number in coding regions = 406 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 2 TTTCAATTTGGTTTACAAGTCGATT 1 6 0 GTTTACAAGT 0.996022 -81 TGTAAACCAAATTGAAAAGATTTAGGTTTA 1 19 1 ATTGAAAAGA 0.974719 -68 AAAGATTTAGGTTTACAAGTCTACACCGAA 1 34 1 GTTTACAAGT 0.996022 -53 TCTACACCGAATTAACAACAAAAAACACGT 1 53 1 ATTAACAACA 0.974719 -34 ********** Masking position 5 Map Score: 5.02274 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 45 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 ATTTGGTTTACAAGTCGATT 1 1 0 CAAGTCGATT 0.99406 -86 ACTTGTAAACCAAATTGAAAAGATTTAGGT 1 16 1 CAAATTGAAA 0.975413 -71 TTTAGGTTTACAAGTCTACACCGAATTAAC 1 39 1 CAAGTCTACA 0.993803 -48 ********** Masking position 3 Map Score: 0.732487 Number of sites scoring better than the average of aligned sites = 172 Number in coding regions = 148 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0