AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i100_mgen_mpneu_100.orf -o100_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMG03444 167 Mycoplasma Input sequences: #1 RMG01751 167 Mycoplasma #2 RMP00381 34 Mycoplasma_pneumoniae #3 RMP00382 34 Mycoplasma_pneumoniae Motif number 1 AAAATTCGTTGGGTAATAGTCTCACCTCAGC 1 57 1 GGGTAATATC 0.977251 -111 ACTCACCACTTGGTTAAAAAAAATTGGCTGA 1 83 0 TGGTTAAAAA 0.963981 -85 CAAAACCAGATGGTAAAACTCACCACTTGGT 1 100 0 TGGTAAAATC 0.99499 -68 ACCTTGGTAAAATTATATTTGATAG 1 153 0 TGGTAAAATA 0.996456 -15 atgctggtaaaattatatttatatt 3 5 1 tggtaaaata 0.996456 -30 ******** ** Masking position 6 Map Score: 8.45751 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 13 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 TGTTTGGAAGTTTGCTGTTATTT 1 3 0 TTTCTGTTAT 0.980502 -165 ATATCTATTGCATCTTGTTTGGAAGTTTGCT 1 18 0 CATTTGTTTG 0.942456 -150 ACCCAACGAATTTTTTGTTTTTATATCTATT 1 40 0 TTTTTGTTTT 0.982875 -128 TGAGTTTTACCATCTGGTTTTGTCTTCTTGT 1 109 1 CATTGGTTTT 0.942457 -59 CTGGTTTTGTCTTCTTGTCATTAAAAGAACG 1 122 1 CTTTTGTCAT 0.9838 -46 catttactgttatatttatatta 2 3 1 tttctgttat 0.980482 -32 aaattatatttatattgtcatttac 3 20 1 tatttgtcat 0.974761 -15 *** ******* Masking position 8 Map Score: 8.02699 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 206 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AACAAGATGCAATAGATATAAAAACAAAAA 1 30 1 AATAGATATA 0.944675 -138 AAAGAACGCTATCAAATATAATTTTACCAA 1 145 1 ATCAAATATA 0.945517 -23 accattttaatataaatataacagtaaatg 2 11 0 tataaatata 0.739659 -24 taaatgacaatataaatataattttaccag 3 14 0 tataaatata 0.739659 -21 ********** Masking position 6 Map Score: 3.63775 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 7 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 AAATAACAGCAAACTTCCAAACAAGA 1 7 1 CAGCAAACTT 0.980569 -161 GACTATTACCCAACGAATTTTTTGTTTTTA 1 48 0 CAACGAATTT 0.988009 -120 AGTCTCACCTCAGCCAATTTTTTTTAACCA 1 74 1 CAGCCAATTT 0.995751 -94 tacgaccattttaatataaata 2 23 0 cgaccatttt 0.972405 -12 ********** Masking position 6 Map Score: 2.61273 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 28 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: -4.52315e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.52315e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.52315e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0