AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i100_mgen_mpneu_300.orf -o100_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMG03444 167 Mycoplasma Input sequences: #1 RMG01751 167 Mycoplasma #2 RMP00381 34 Mycoplasma_pneumoniae #3 RMP00382 34 Mycoplasma_pneumoniae Motif number 1 AAAATTCGTTGGGTAATAGTCTCACCTCAGC 1 57 1 GGGTAATATC 0.976577 -111 ACTCACCACTTGGTTAAAAAAAATTGGCTGA 1 83 0 TGGTTAAAAA 0.962935 -85 CAAAACCAGATGGTAAAACTCACCACTTGGT 1 100 0 TGGTAAAATC 0.994949 -68 ACCTTGGTAAAATTATATTTGATAG 1 153 0 TGGTAAAATA 0.996355 -15 atgctggtaaaattatatttatatt 3 5 1 tggtaaaata 0.996355 -30 ******** ** Masking position 6 Map Score: 8.45751 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 13 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 AAATAACAGCAAACTTCCAAACA 1 3 1 ATAACAGAAA 0.980502 -165 AGCAAACTTCCAAACAAGATGCAATAGATAT 1 18 1 CAAACAAATG 0.942456 -150 AATAGATATAAAAACAAAAAATTCGTTGGGT 1 40 1 AAAACAAAAA 0.982875 -128 ACAAGAAGACAAAACCAGATGGTAAAACTCA 1 109 0 AAAACCAATG 0.942457 -59 CGTTCTTTTAATGACAAGAAGACAAAACCAG 1 122 0 ATGACAAAAG 0.9838 -46 taatataaatataacagtaaatg 2 3 0 ataacagaaa 0.980482 -32 gtaaatgacaatataaatataattt 3 20 0 atgacaaata 0.974761 -15 ******* *** Masking position 4 Map Score: 8.02699 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 206 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 CAAGATGCAATAGATATAAAAACAAAAAAT 1 32 1 TAGATATAAA 0.960839 -136 ACCACTTGGTTAAAAAAAATTGGCTGAGGT 1 80 0 TAAAAAAAAT 0.890796 -88 AGAACGCTATCAAATATAATTTTACCAAGG 1 147 1 CAAATATAAT 0.975433 -21 tacgaccattttaatataaatataacagta 2 15 0 ttaatataaa 0.885035 -20 aatgacaatataaatataattttaccagca 3 12 0 taaatataat 0.988475 -23 ********** Masking position 6 Map Score: 4.06613 Number of sites scoring better than the average of aligned sites = 69 Number in coding regions = 60 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 AAATAACAGCAAACTTCCAAACAAGA 1 7 1 CAGCAAACTT 0.980288 -161 GACTATTACCCAACGAATTTTTTGTTTTTA 1 48 0 CAACGAATTT 0.987834 -120 AGTCTCACCTCAGCCAATTTTTTTTAACCA 1 74 1 CAGCCAATTT 0.995689 -94 tacgaccattttaatataaata 2 23 0 cgaccatttt 0.972008 -12 ********** Masking position 6 Map Score: 2.61273 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 28 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: -4.52315e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.52315e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.52315e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0