AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i032_mjan_pyro_300.orf -o032_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01532 194 Pyrococcus_OT3 Motif number 1 AATTAACCTTTTTATCCAAATCATCTTCCAT 1 43 1 TTTTCCAAAT 0.98875 -152 TATTTGAAAGTTTATCAAAATTTTCGAGCAT 1 76 0 TTTTCAAAAT 0.971024 -119 CGTTGTTTCTTTTTTGAACATTAATGTCCAT 1 122 1 TTTTGAACAT 0.932519 -73 GATGTTTACATTTGTCAACATTTAAAGCTTT 1 158 0 TTTTCAACAT 0.994615 -37 *** ******* Masking position 5 Map Score: 5.54451 Number of sites scoring better than the average of aligned sites = 139 Number in coding regions = 123 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 TTCTACCACCATCCTAAGATTCTGGGTTCGTTA 1 10 1 CTCCTAATCT 0.996848 -185 TCCAAATCATCTTCCATAAATGCTCGAAAATTTT 1 57 1 CTCCAAATCT 0.99875 -138 TTTTGATAAACTTTCAAATATCCTCCCATTTTGC 1 87 1 CTTCAAATCT 0.995052 -108 CATTAATGTCCATCTACAAAAGCTTTAAATGTTG 1 140 1 CTCTAAAACT 0.987592 -55 * **** * ** ** Masking position 8 Map Score: 2.80603 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 17 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CCCAGAATCTTAGGATGGTGGTAGAA 1 7 0 TAGGATGGTG 0.979159 -188 AGCATTTATGGAAGATGATTTGGATAAAAA 1 51 0 GAAGATGATT 0.954916 -144 ACGAGCAAAATGGGAGGATATTTGAAAGTT 1 95 0 TGGGAGGATA 0.988641 -100 ACATCAGAGTGGGGATGATAA 1 184 1 GGGGATGATA 0.995654 -11 ********** Masking position 5 Map Score: 0.997031 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 219 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 4 CCATAAATGCTCGAAAATTTTGATAAACTT 1 70 1 TCGAAAATTT 0.969202 -125 GGGAGGATATTTGAAAGTTTATCAAAATTT 1 84 0 TTGAAAGTTT 0.98778 -111 TTTGTCAACATTTAAAGCTTTTGTAGATGG 1 149 0 TTTAAAGCTT 0.968407 -46 TCATCCCCACTCTGATGTTTACATTTGTCA 1 172 0 TCTGATGTTT 0.949406 -23 ********** Masking position 5 Map Score: 0.440867 Number of sites scoring better than the average of aligned sites = 332 Number in coding regions = 293 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0