AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i038_mjan_pyro_300.orf -o038_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00721 54 Pyrococcus_OT3 #2 RPH00717 92 Pyrococcus_OT3 Motif number 1 TTTGACTATTATAGTCAAAAC 2 2 0 ATAGTCAAAA 0.997699 -91 TTTGACTATAATAGTCAAAAACTTAATAAA 2 13 1 ATAGTCAAAA 0.997699 -80 GCTCACTCACATTGTCGAAAATTTTATTAA 2 35 0 ATTGTCGAAA 0.9931 -58 GTAATGTTGTAGAGTCTAAAAATCTTCAAG 2 64 0 AGAGTCTAAA 0.993117 -29 ********** Masking position 5 Map Score: 9.17926 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 18 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 CACCAACCTTAAAATTGTTTAGTTCAAAGTAT 1 28 0 AAATTGTTAG 0.992367 -27 AAACAATTTTAAGGTTGGTGAGAGT 1 40 1 AAGTTGGTAG 0.99821 -15 CATTGTCGAAAATTTTATTAAGTTTTTGACTA 2 24 0 AATTTATTAG 0.982965 -69 AATTTTCGACAATGTGAGTGAGCTTGAAGATT 2 42 1 AAGTGAGTAG 0.99111 -51 AAAGATCAGTAATGTTGTAGAGTCTAAAAATC 2 70 0 AAGTTGTAAG 0.993671 -23 ** ****** ** Masking position 5 Map Score: 6.12752 Number of sites scoring better than the average of aligned sites = 148 Number in coding regions = 139 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0