AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i195_mjan_pyro_100.orf -o195_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ16446 239 M_jannaschii_ECEL #2 RMJ10805 28 M_jannaschii_chromosome #3 RMJ04288 67 M_jannaschii_chromosome #4 RMJ16676 62 M_jannaschii_chromosome #5 RMJ01438 300 M_jannaschii_chromosome #6 RMJ03243 87 M_jannaschii_chromosome Motif number 1 ACAAATCTCTTTACATAGAGAGGTTATGGCA 1 65 0 TTACATAGGA 0.994231 -175 CCATACAAAATTAGGTAGATAATTTTAATTT 3 40 0 TTAGGTAGTA 0.964946 -28 GTAGAAATTATTATATAGAGATAAACTTATG 5 139 1 TTATATAGGA 0.977478 -162 TCTAAAAGTATTACATAGCTAAATTGGACAT 5 254 0 TTACATAGTA 0.99096 -47 CTACATCCAATTACATAGTGAAAACATTAAA 6 43 1 TTACATAGGA 0.994164 -45 TATCACCAACTTAGATAGTTATTTTAATGTT 6 65 0 TTAGATAGTA 0.986889 -23 ******** ** Masking position 6 Map Score: 8.95582 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 23 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 AGTTTAGGAGATAACTAAAATCGAATATCTG 1 27 1 ATACTAAAAT 0.953689 -213 ATCATTAACTAATATTTAAATATATTTGTAA 1 98 1 AAATTTAAAT 0.942537 -142 TAAAAATCCTATAACTTAAATGAATAGAAAG 1 126 1 ATACTTAAAT 0.866808 -114 AGATACACTAAAAATTACAATGTATATGGTG 1 212 1 AAATTACAAT 0.923825 -28 ATAGGTAGATTAAATTAAAATTATCTACCTA 3 29 1 TAATTAAAAT 0.902933 -39 ATTAAAATTCATAATGAAAATTTGAACGCCT 5 26 0 ATATGAAAAT 0.907724 -275 TTTTGCAAAAGTCATTAAAATTCATAATGAA 5 39 0 GTATTAAAAT 0.917968 -262 TTTTTTAAAGAATATTAAAATACTACAAAAA 5 79 0 AAATTAAAAT 0.981035 -222 ACATAGTGAAAACATTAAAATAACTATCTAA 6 55 1 AAATTAAAAT 0.981097 -33 ** ******** Masking position 4 Map Score: 8.60034 Number of sites scoring better than the average of aligned sites = 505 Number in coding regions = 309 Number in noncoding regions = 196 Number of orfs with sites within 600 bp upstream = 172 Fraction of orfs with sites within 600 bp upstream = 0.0276261 Motif number 3 TTCCATTCCTAGTATCCGCAGAAAGATACA 1 189 1 AGTATCCGCA 0.962881 -51 TGTATCACCATACAAAATTA 3 58 0 TGTATCACCA 0.975924 -10 GAGGTGTTAGGGTATCCCAATAGGGTTTCC 4 41 1 GGTATCCCAA 0.993829 -22 ATGGACGTCGGGTATCCCAATAGGGCGGAG 5 198 0 GGTATCCCAA 0.993829 -103 GGTATCACCAACTTAGATAG 6 78 0 GGTATCACCA 0.993829 -10 ********** Masking position 5 Map Score: 6.87139 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 8 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 AGAAAGCTTAGGATTAAATTAGAGGTTAGTT 1 151 1 GGATAAATTA 0.958208 -89 ATTAGAGGTTAGTTTATATTATTCCATTCCT 1 168 1 AGTTATATTA 0.971032 -72 ATAAAGTATATATAAGAGATAGGTA 3 5 1 AGTTATATAA 0.935826 -63 AGAGATAGGTAGATTAAATTAAAATTATCTA 3 25 1 AGATAAATTA 0.949967 -43 TACGCTCGGAGGTGTAAATTATTT 4 4 0 GGTTAAATTA 0.981381 -59 GCTTAAACTAAGTAGAAATTATTATATAGAG 5 128 1 AGTGAAATTA 0.930703 -173 TTGGATGTAGGGTGTATATAAAGGTTGTGGT 6 22 0 GGTTATATAA 0.946265 -66 *** ******* Masking position 6 Map Score: 6.24572 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 65 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 5 AATATATTTGTAAAAATCCTATAACTTAAAT 1 116 1 TAAAAATCTA 0.949145 -124 CTTAAATGAATAGAAAGCTTAGGATTAAATT 1 140 1 TAGAAAGCTA 0.966012 -100 CAAAAGTCATTAAAATTCATAATGAAAATTT 5 34 0 TAAAATTCTA 0.950502 -267 AATATTCTTTAAAAAAGCATATAAAATGCTT 5 94 1 AAAAAAGCTA 0.954084 -207 AAAAAGCATATAAAATGCTTACTGCTTAAAC 5 105 1 TAAAATGCTA 0.975795 -196 ******** ** Masking position 5 Map Score: 2.39885 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 48 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 6 TAGGGTATCCCAATAGGGTTTCCCT 4 48 1 CAATAGGGTT 0.98888 -15 TTGCAAAAAACTATAGGTTTTTGTAGTATT 5 62 1 CTATAGGTTT 0.92697 -239 CATTTCCTATCCATAGGGCTCCGCCCTATT 5 180 1 CCATAGGGCT 0.991425 -121 TCGGGTATCCCAATAGGGCGGAGCCCTATG 5 191 0 CAATAGGGCG 0.987757 -110 ********** Masking position 5 Map Score: 1.56284 Number of sites scoring better than the average of aligned sites = 62 Number in coding regions = 17 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 7 AGATAACTAAAATCGAATATCTGTTAGGAGTG 1 35 1 AACGATATCT 0.956224 -205 AGTTAATGATAAACAAATCTCTTTACATAGAG 1 76 0 AACAATCTCT 0.966316 -164 GGAATAATATAAACTAACCTCTAATTTAATCC 1 161 0 AACTACCTCT 0.976713 -79 TTCTGCTCATAAGTTTATCTCTATATAATAAT 5 145 0 AATTATCTCT 0.969857 -156 TATGGATAGGAAATGCATTTCTGCTCATAAGT 5 163 0 AATGATTTCT 0.932833 -138 AATTGCACCTCTTTTTTAAAAC 5 289 0 AATGACCTCT 0.983631 -12 ** ** ****** Masking position 7 Map Score: 2.01548 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 50 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 8 AGCTTAGGATTAAATTAGAGGTTAGTTTAT 1 155 1 TAAATTAGAG 0.916867 -85 CGACGTCCATTAAGTTGGGGCTTTCAGCCC 5 218 1 TAAGTTGGGG 0.989702 -83 AAATTGGACATTAATTGGGGCTGAAAGCCC 5 235 0 TTAATTGGGG 0.964361 -66 ATTACATAGCTAAATTGGACATTAATTGGG 5 246 0 TAAATTGGAC 0.94235 -55 AATAACTATCTAAGTTGGTGATACC 6 73 1 TAAGTTGGTG 0.972402 -15 ********** Masking position 5 Map Score: 2.43557 Number of sites scoring better than the average of aligned sites = 89 Number in coding regions = 61 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 9 TATCTCCTAAACTATACCAAGTAATTTTT 1 8 0 ACTATACAAT 0.906846 -232 TGTTAGGAGTGCCATAACCTCTCTATGTAAAG 1 56 1 GCCATACCTT 0.924636 -184 AATACATCACCATATACATTGTAATTTTTA 1 220 0 ACCATAACAT 0.977034 -20 TTATACCATTGCCAATCCACCATGGA 2 5 1 ACCATTCCAT 0.951264 -24 TGTATCACCATACAAAATTAGGTAGATA 3 50 0 ACCATAAAAT 0.943316 -18 TCTTTAAAAAAGCATATAAAATGCTTACTGCT 5 99 1 AGCATAAAAT 0.73363 -202 CTCTCACCAAACCACAACCTTTATATACACCC 6 12 1 ACCACACCTT 0.957589 -76 TTATATACACCCTACATCCAATTACATAGTGA 6 32 1 CCTACACCAT 0.812758 -56 ****** *** * Masking position 4 Map Score: 0.535888 Number of sites scoring better than the average of aligned sites = 339 Number in coding regions = 311 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 10 AAATAATTTACACCTCCGAGCGTAAGCGA 4 10 1 ACACCTCCGA 0.980995 -53 GGATACCCTAACACCTCCTCGCTTACGCTC 4 28 0 ACACCTCCTC 0.96697 -35 ACGCCTTCCAAAGGAAGGCG 5 1 1 ACGCCTTCCA 0.989582 -300 GAAAATTTGAACGCCTTCCTTTGGAAGGCG 5 12 0 ACGCCTTCCT 0.981752 -289 ********** Masking position 6 Map Score: 0.226755 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 8 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 11 ********** No masking Map Score: 1.29562e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 12 ********** No masking Map Score: 1.29562e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 13 ********** No masking Map Score: 1.29562e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0