AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i195_mjan_pyro_300.orf -o195_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ16446 239 M_jannaschii_ECEL #2 RMJ16608 74 M_jannaschii_ECEL #3 RMJ10805 28 M_jannaschii_chromosome #4 RMJ04288 67 M_jannaschii_chromosome #5 RMJ16676 62 M_jannaschii_chromosome #6 RMJ01438 300 M_jannaschii_chromosome #7 RMJ03243 87 M_jannaschii_chromosome Motif number 1 AGTTTAGGAGATAACTAAAATCGAATATCTG 1 27 1 ATACTAAAAT 0.958959 -213 ATCATTAACTAATATTTAAATATATTTGTAA 1 98 1 AAATTTAAAT 0.930342 -142 TAAAAATCCTATAACTTAAATGAATAGAAAG 1 126 1 ATACTTAAAT 0.866586 -114 AGATACACTAAAAATTACAATGTATATGGTG 1 212 1 AAATTACAAT 0.909256 -28 AATGTCCTAAAACTAAAATAAAACTCCCG 2 56 0 AAACTAAAAT 0.971599 -19 ATAGGTAGATTAAATTAAAATTATCTACCTA 4 29 1 TAATTAAAAT 0.883372 -39 ATTAAAATTCATAATGAAAATTTGAACGCCT 6 26 0 ATATGAAAAT 0.872489 -275 TTTTGCAAAAGTCATTAAAATTCATAATGAA 6 39 0 GTATTAAAAT 0.88463 -262 TTTTTTAAAGAATATTAAAATACTACAAAAA 6 79 0 AAATTAAAAT 0.979579 -222 ACATAGTGAAAACATTAAAATAACTATCTAA 7 55 1 AAATTAAAAT 0.979611 -33 ** ******** Masking position 4 Map Score: 12.2215 Number of sites scoring better than the average of aligned sites = 278 Number in coding regions = 170 Number in noncoding regions = 108 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 2 TGCCATAACCTCTCTATGTAAAGAGATTTGT 1 65 1 TCCTATGTAA 0.991956 -175 AAATTAAAATTATCTACCTAATTTTGTATGG 4 40 1 TACTACCTAA 0.951673 -28 CATAAGTTTATCTCTATATAATAATTTCTAC 6 139 0 TCCTATATAA 0.968796 -162 ATGTCCAATTTAGCTATGTAATACTTTTAGA 6 254 1 TACTATGTAA 0.987411 -47 TTTAATGTTTTCACTATGTAATTGGATGTAG 7 43 0 TCCTATGTAA 0.991908 -45 AACATTAAAATAACTATCTAAGTTGGTGATA 7 65 1 TACTATCTAA 0.981769 -23 ** ******** Masking position 6 Map Score: 8.44096 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 23 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 TTCCATTCCTAGTATCCGCAGAAAGATACA 1 189 1 AGTATCCGCA 0.960385 -51 TGTATCACCATACAAAATTA 4 58 0 TGTATCACCA 0.974281 -10 GAGGTGTTAGGGTATCCCAATAGGGTTTCC 5 41 1 GGTATCCCAA 0.9934 -22 ATGGACGTCGGGTATCCCAATAGGGCGGAG 6 198 0 GGTATCCCAA 0.9934 -103 GGTATCACCAACTTAGATAG 7 78 0 GGTATCACCA 0.9934 -10 ********** Masking position 5 Map Score: 6.43945 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 8 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 TCCTAAACTATACCAAGTAATTTTT 1 6 0 TACCAAGTAA 0.917804 -234 AATACATCACCATATACATTGTAATTT 1 223 0 CACCATATAC 0.883999 -17 TATAATACCAAATCAACATAATACA 2 6 1 TACCAAATCA 0.839665 -69 ATTGCCAATCCACCATGGAAC 3 18 1 CACCATGGAA 0.92054 -11 TGTATCACCATACAAAATTAGGTAG 4 53 0 CACCATACAA 0.946981 -15 GGGCTGAAAGCCCCAACTTAATGGACGTCG 6 218 0 CCCCAACTTA 0.87471 -83 GGGCTTTCAGCCCCAATTAATGTCCAATTT 6 235 1 CCCCAATTAA 0.874871 -66 TCTCTCACCAAACCACAACCTTTAT 7 6 1 CACCAAACCA 0.936741 -82 TTAATGTTTTCACTATGTAATTGGATGTAG 7 43 0 CACTATGTAA 0.794028 -45 GGTATCACCAACTTAGATAGTTATT 7 73 0 CACCAACTTA 0.941984 -15 ********** Masking position 5 Map Score: 2.79436 Number of sites scoring better than the average of aligned sites = 463 Number in coding regions = 377 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 101 Fraction of orfs with sites within 600 bp upstream = 0.0162223 Motif number 5 AGTTATCTCCTAAACTATACCAAGTAATTTT 1 12 0 TAAACTAACC 0.88018 -228 AACTAACCTCTAATTTAATCCTAAGCTTTCT 1 151 0 TAATTTATCC 0.942218 -89 AGGAATGGAATAATATAAACTAACCTCTAAT 1 168 0 TAATATAACT 0.949835 -72 GTCCTAAAACTAAAATAAAACTCCCGATTTC 2 51 0 TAAAATAAAC 0.776435 -24 TACCTATCTCTTATATATACTTTAT 4 5 0 TTATATAACT 0.84034 -63 TAGATAATTTTAATTTAATCTACCTATCTCT 4 25 0 TAATTTATCT 0.874355 -43 AAATAATTTACACCTCCGAGCGTA 5 4 1 TAATTTAACC 0.972982 -59 TAAAGAATATTAAAATACTACAAAAACCTAT 6 74 0 TAAAATATAC 0.611284 -227 CTCTATATAATAATTTCTACTTAGTTTAAGC 6 128 0 TAATTTCACT 0.762192 -173 ACCACAACCTTTATATACACCCTACATCCAA 7 22 1 TTATATAACC 0.925 -66 ******* *** Masking position 6 Map Score: 5.30986 Number of sites scoring better than the average of aligned sites = 352 Number in coding regions = 289 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 6 AATATATTTGTAAAAATCCTATAACTTAAAT 1 116 1 TAAAAATCTA 0.948409 -124 CTTAAATGAATAGAAAGCTTAGGATTAAATT 1 140 1 TAGAAAGCTA 0.964427 -100 CAAAAGTCATTAAAATTCATAATGAAAATTT 6 34 0 TAAAATTCTA 0.948311 -267 AATATTCTTTAAAAAAGCATATAAAATGCTT 6 94 1 AAAAAAGCTA 0.951606 -207 AAAAAGCATATAAAATGCTTACTGCTTAAAC 6 105 1 TAAAATGCTA 0.974855 -196 ******** ** Masking position 5 Map Score: 1.96986 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 48 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 7 CACTCCTAACAGATATTCGATTTTAGTTATCT 1 35 0 AGATATCGTT 0.948831 -205 CTCTATGTAAAGAGATTTGTTTATCATTAACT 1 76 1 AGAGATTGTT 0.960559 -164 GGATTAAATTAGAGGTTAGTTTATATTATTCC 1 161 1 AGAGGTAGTT 0.972682 -79 ATTATTATATAGAGATAAACTTATGAGCAGAA 6 145 1 AGAGATAATT 0.964681 -156 ACTTATGAGCAGAAATGCATTTCCTATCCATA 6 163 1 AGAAATCATT 0.921818 -138 GTTTTAAAAAAGAGGTGCAATT 6 289 1 AGAGGTCATT 0.980774 -12 ****** ** ** Masking position 6 Map Score: 1.50422 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 50 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 8 AGGGAAACCCTATTGGGATACCCTA 5 48 0 AACCCTATTG 0.988419 -15 AATACTACAAAAACCTATAGTTTTTTGCAA 6 62 0 AAACCTATAG 0.92414 -239 AATAGGGCGGAGCCCTATGGATAGGAAATG 6 180 0 AGCCCTATGG 0.991069 -121 CATAGGGCTCCGCCCTATTGGGATACCCGA 6 191 1 CGCCCTATTG 0.98725 -110 ********** Masking position 6 Map Score: 1.21734 Number of sites scoring better than the average of aligned sites = 62 Number in coding regions = 17 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 9 ********** No masking Map Score: 6.20604e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ATTTTTACAAATATATTTAAATATTAGTTA 1 103 0 ATATATTTAA 0.623393 -137 TAAGCTTTCTATTCATTTAAGTTATAGGAT 1 131 0 ATTCATTTAA 0.914518 -109 CATATACATTGTAATTTTTAGTGTATCTTT 1 210 0 GTAATTTTTA 0.44422 -30 AATACATTTTGTACATTTAATGAAATCGGG 2 30 1 GTACATTTAA 0.883827 -45 AATTAGGTAGATAATTTTAATTTAATCTAC 4 33 0 ATAATTTTAA 0.888412 -35 TTTTTGCAAAAGTCATTAAAATTCATAATG 6 41 0 AGTCATTAAA 0.561344 -260 AGGTTTTTGTAGTATTTTAATATTCTTTAA 6 76 1 AGTATTTTAA 0.774287 -225 GTATTTTAATATTCTTTAAAAAAGCATATA 6 87 1 ATTCTTTAAA 0.813334 -214 TAGCTATGTAATACTTTTAGATTTCGTTTT 6 264 1 ATACTTTTAG 0.765742 -37 AACTTAGATAGTTATTTTAATGTTTTCACT 7 59 0 GTTATTTTAA 0.850254 -29 ********** Masking position 6 Map Score: 0.764203 Number of sites scoring better than the average of aligned sites = 1639 Number in coding regions = 1329 Number in noncoding regions = 310 Number of orfs with sites within 600 bp upstream = 275 Fraction of orfs with sites within 600 bp upstream = 0.0441696 Motif number 11 ********** No masking Map Score: 6.20604e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 12 ********** No masking Map Score: 6.20604e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 13 ********** No masking Map Score: 6.20604e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0