AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i223_mjan_pyro_300.orf -o223_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01735 233 Pyrococcus_OT3 #2 RPH01736 42 Pyrococcus_OT3 Motif number 1 CTTGTTTTTGTCAAAAATCCTTTTAAGTAA 1 29 0 TCAAAAATCC 0.97352 -205 CGTCTCTCCTTTAAAAAACTTTGCTAGCTT 1 56 0 TTAAAAAACT 0.966691 -178 AGGAGAGACGTCAAAGAACTAATTTGATGA 1 76 1 TCAAAGAACT 0.996621 -158 GTTCGAAAAATCAAAGAAGTTCATTGCTTT 1 141 0 TCAAAGAAGT 0.988204 -93 AACCAAAGATTCAAAAATCTTTCGGAACAG 1 182 0 TCAAAAATCT 0.990152 -52 GGTTAACATTTCAAAGAAATTCCGAGGTGG 1 208 1 TCAAAGAAAT 0.982616 -26 ********** Masking position 5 Map Score: 11.14 Number of sites scoring better than the average of aligned sites = 131 Number in coding regions = 114 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 TTTTTGACAAAAACAAGCTAGCAAAGTTTT 1 42 1 AAACAAGCTA 0.970563 -192 GATGATTAGGGAACAAGATATCAGCTTTAA 1 101 1 GAACAAGATA 0.986299 -133 TAACGAATTAGTAAAAGCAATGAACTTCTT 1 128 1 GTAAAAGCAA 0.970971 -106 TAGCATGTTCGAAAAATCAAAGAAGTTCAT 1 147 0 GAAAAATCAA 0.978638 -87 TTGATTTTTCGAACATGCTATCCAACTGTT 1 157 1 GAACATGCTA 0.981135 -77 TAAGAAGGTGGAAAAATAAAGT 2 3 0 GAAAAATAAA 0.939323 -40 ********** Masking position 5 Map Score: 6.6313 Number of sites scoring better than the average of aligned sites = 448 Number in coding regions = 407 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 3 CCGAAAGATTTTTGAATCTTTGGTTAACAT 1 187 1 TTTGAATCTT 0.920417 -47 TCCTTACCACCTCGGAATTTCTT 1 221 0 TTACCACCTC 0.983801 -13 ACTTTATTTTTCCACCTTCTTATTTATT 2 9 1 TTTCCACCTT 0.994552 -34 GATTTGCACCTATTAATAAATA 2 31 0 TTTGCACCTA 0.990424 -12 ********** Masking position 6 Map Score: 2.11127 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 30 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0