AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i316_mjan_pyro_300.orf -o316_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01790 122 Pyrococcus_OT3 Motif number 1 CTCCTTCACCTCCTCGCCAGGCCCGGTG 1 9 1 CCTCCTCGCC 0.998825 -114 GAAAGGGAACCCACCGGGCCTGGCGAGGAG 1 20 0 CCACCGGGCC 0.996991 -103 CTTTCGGACACCCCCGAGCCGTGCTAAGTG 1 45 1 CCCCCGAGCC 0.996991 -78 ********** Masking position 5 Map Score: 6.23369 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 1 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CTCCTTCACCTCCTCGCCAGGC 1 2 1 TCCTCACCTC 0.985522 -121 CTTCACCTCCTCGCCAGGCCCGGTGGGTTCC 1 14 1 TCGCAGGCCC 0.995487 -109 GGGTTCCCTTTCGGACACCCCCGAGCCGTGC 1 38 1 TCGGCACCCC 0.99756 -85 CATGATCACTTAGCACGGCTCGGGGGTGTCC 1 50 0 TAGCCGGCTC 0.991639 -73 **** ****** Masking position 1 Map Score: 0.839235 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 5 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 TAAAGATTTTTAAAGGTACTTTATAACCCA 1 87 0 TAAAGGTACT 0.98583 -36 GAATCTTAAGTAAAGATTTTTAAAGGTACT 1 97 0 TAAAGATTTT 0.976496 -26 AAATCTTTACTTAAGATTCCAAGTG 1 108 1 TTAAGATTCC 0.985728 -15 ********** Masking position 4 Map Score: 0.12119 Number of sites scoring better than the average of aligned sites = 88 Number in coding regions = 88 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0