AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i322_mjan_pyro_100.orf -o322_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01018 214 Pyrococcus_OT3 Motif number 1 TTGATATTTTGTTCAACTTTTCGCT 1 4 1 ATATTTGTCA 0.9986 -211 AATTGCAGTTATATTTTGTACATAAGACGGAT 1 71 0 ATATTTGTCA 0.9986 -144 ATATCCAATAATATTTAGTCAAAATTCTAAAA 1 102 0 ATATTTGTAA 0.992734 -113 ATATTATTGGATATTTTATCCAATTCTCAAGC 1 120 1 ATATTTATCA 0.992735 -95 CACCTCTTGGATATTTTGTCCAACTTGGAGAT 1 188 0 ATATTTGTCA 0.9986 -27 ****** ** ** Masking position 6 Map Score: 14.4064 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 12 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 AAATCAATAAAGCGAAAAGTTGAACAAAATATCA 1 12 0 AGCAAAGTGA 0.995549 -203 ATACATTATTATCAAATAGATGAAAGTAAATCAA 1 39 0 ATCAAAGTGA 0.983313 -176 TTAGTCAAAATTCTAAAAATTGCAGTTATATTTT 1 86 0 TTCAAAATGA 0.971053 -129 TGAATCTGCTATCTCCAAGTTGGACAAAATATCC 1 178 1 ATCCCAGTGA 0.990627 -37 TGGACAAAATATCCAAGAGGTGAAAGT 1 198 1 ATCAAAGTGA 0.997991 -17 *** ** ** ** * Masking position 8 Map Score: 6.36881 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 34 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 GTACAAAATATAACTGCAATTTTTAGAATT 1 82 1 TAACTGCAAT 0.924196 -133 ATATTTAGTCAAAATTCTAAAAATTGCAGT 1 94 0 AAAATTCTAA 0.875319 -121 AATTGGATAAAATATCCAATAATATTTAGT 1 115 0 AATATCCAAT 0.97559 -100 CCTCATGCCATAAATCCTAAAAGCCTTGAA 1 152 1 TAAATCCTAA 0.937302 -63 AAAAGCCTTGAATCTGCTATCTCCAAGTTG 1 170 1 AATCTGCTAT 0.95789 -45 AGTTGGACAAAATATCCAAGAGGTGAAAGT 1 195 1 AATATCCAAG 0.959091 -20 ********** Masking position 5 Map Score: 2.453 Number of sites scoring better than the average of aligned sites = 855 Number in coding regions = 761 Number in noncoding regions = 94 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0