AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i324_mjan_pyro_300.orf -o324_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00371 136 Pyrococcus_OT3 Motif number 1 ATAATAGAACATTAGTATAAATCTTTAAGG 1 42 0 ATTAGTATAA 0.995915 -95 AGATAGCAAAATTTATATAATAGAACATTA 1 58 0 ATTTATATAA 0.948451 -79 ATTTTGCTATCTTAGTATCAAATATATTTA 1 76 1 CTTAGTATCA 0.980193 -61 AATATATTTAAATAGTATAAAGTCGTATAA 1 96 1 AATAGTATAA 0.989745 -41 AATAGTATAAAGTCGTATAATCTATCTAAG 1 106 1 AGTCGTATAA 0.988222 -31 ********** Masking position 6 Map Score: 6.77743 Number of sites scoring better than the average of aligned sites = 90 Number in coding regions = 66 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 CACCTCATGACTATGGATGGGAGATCCTTA 1 17 1 CTATGGATGG 0.990465 -120 GTATAAATCTTTAAGGATCTCCCATCCATA 1 28 0 TTAAGGATCT 0.982526 -109 AAGATTTATACTAATGTTCTATTATATAAA 1 47 1 CTAATGTTCT 0.956875 -90 TATAATCTATCTAAGGAGGGAGCAGC 1 121 1 CTAAGGAGGG 0.995027 -16 ********** Masking position 3 Map Score: 2.17182 Number of sites scoring better than the average of aligned sites = 91 Number in coding regions = 83 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0