AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i347_mjan_pyro_300.orf -o347_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ12183 300 M_jannaschii_chromosome #2 RPH00141 201 Pyrococcus_OT3 Motif number 1 TTAATATTAATAATGGATATTTGAACGCTC 1 24 0 TAATGGATAT 0.97164 -277 ATTTCTTTTATTATGATTATCCTCCAAATT 1 87 1 TTATGATTAT 0.980148 -214 ATAAAAGGAAATATGATTATAAAACTGACT 1 123 0 ATATGATTAT 0.911843 -178 ATATTTCCTTTTATGGATATTATAGAGCGG 1 139 1 TTATGGATAT 0.979239 -162 GAGCGGTAGCTTATGGTTATTTAAATTTTA 1 163 1 TTATGGTTAT 0.990104 -138 AATAAATTTTTAATGATTAATGCTAAATAG 1 240 0 TAATGATTAA 0.904871 -61 TAAATAACGTTTATGGAAAAGATTCAATAG 1 278 1 TTATGGAAAA 0.876592 -23 ********** Masking position 3 Map Score: 8.74899 Number of sites scoring better than the average of aligned sites = 273 Number in coding regions = 243 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 ATTACCTGTAGGGTCCCGCGGTAGCCTAGCC 2 88 1 GGGTCCGCGG 0.9995 -114 AGCCTAGCCTGGGAGTGGCGGCGGACTGTAG 2 110 1 GGGAGTGCGG 0.99471 -92 ATTTGAACCGGGGACCTGCGGATCTACAGTC 2 133 0 GGGACCGCGG 0.999501 -69 AGAATTCTGGTGGTCCCGCGGCCCGGATTTG 2 159 0 TGGTCCGCGG 0.99802 -43 ****** **** Masking position 8 Map Score: 8.17444 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 TATAGTGTCTTTCAAAGTTGTTAAAATTAAT 1 49 0 TTCAAAGTTT 0.981834 -252 ACACTATATTTTAAAATTTCTTTTATTATGA 1 72 1 TTAAAATTTT 0.977777 -229 ATGATTATCCTCCAAATTTATTGAAGTCAGT 1 99 1 TCCAAATTTT 0.960907 -202 GTGAAATCATTTAAAATTTAAATAACCATAA 1 173 0 TTAAAATTTA 0.726016 -128 TATCCAAGATTACAAATCTATTTAGCATTAA 1 223 1 TACAAATCTT 0.918367 -78 CATTAATCATTAAAAATTTATTTCCCAGTAT 1 248 1 TAAAAATTTT 0.961459 -53 AATGTGGGTTTATAAAGTTTTCGCGAGGAGT 2 39 0 TATAAAGTTT 0.912664 -163 ATTAATCGCCTTAAAAGTTGTGAGAATTCTG 2 181 0 TTAAAAGTTT 0.977967 -21 ********* * Masking position 6 Map Score: 7.81843 Number of sites scoring better than the average of aligned sites = 558 Number in coding regions = 399 Number in noncoding regions = 159 Number of orfs with sites within 600 bp upstream = 152 Fraction of orfs with sites within 600 bp upstream = 0.0244137 Motif number 4 ATATTAATAATGGATATTTGAACGCTCTCCT 1 20 0 TGGATATTTA 0.994999 -281 TTTCCTTTTATGGATATTATAGAGCGGTAGC 1 142 1 TGGATATTAA 0.98748 -159 CGGTAGCTTATGGTTATTTAAATTTTAAATG 1 166 1 TGGTTATTTA 0.987493 -135 TTTGTAATCTTGGATATTTAATATTGGGTAA 1 208 0 TGGATATTTA 0.994999 -93 ********* * Masking position 6 Map Score: 5.85971 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 34 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 TTGAACGCTCTCCTATAGGGAGG 1 3 0 TCTATAGGGA 0.969767 -298 AGAAATTTTAAAATATAGTGTCTTTCAAAGT 1 62 0 AATATAGTGT 0.887167 -239 CTTGGATATTTAATATTGGGTAAACTGGTGA 1 200 0 TATATTGGGT 0.966462 -101 TAAACGTTATTTATACTGGGAAATAAATTTT 1 260 0 TATACTGGGA 0.9203 -41 TTATAAACCCACATTTAGTGAGATGATTTTG 2 55 1 AATTTAGTGA 0.845601 -147 TTTAGTGAGATGATTTTGGGATTACCTGTAG 2 68 1 TATTTTGGGA 0.952629 -134 TTTTGGGATTACCTGTAGGGTCCCGCGGTAG 2 81 1 ACTGTAGGGT 0.897267 -121 * ********* Masking position 4 Map Score: 1.04852 Number of sites scoring better than the average of aligned sites = 441 Number in coding regions = 385 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 6 ********** No masking Map Score: -5.09159e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.09159e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -5.09159e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0