AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i008_tpal_bbur_100.orf -o008_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00166 135 AE000520 #2 RTP00167 41 AE000520 #3 RTP00169 57 AE000520 Motif number 1 AAGTTTGAACGCAAGTCAGCT 1 2 0 GCAAGTCAGC 0.975817 -134 ACCGCTTTTGGCGAGGCGTTGTTTGCAATG 1 81 1 GCGAGGCGTT 0.98535 -55 GGCGTTGTTTGCAATGCTGCTAATGAGCGC 1 95 1 GCAATGCTGC 0.993162 -41 GGCGAGCAATGCGTCAAAGTGTTGT 2 6 1 GCAATGCGTC 0.998611 -36 AAGCGGTACCGTAATGCGTCCGTTAATGTC 3 22 0 GTAATGCGTC 0.992821 -36 ********** Masking position 4 Map Score: 7.14009 Number of sites scoring better than the average of aligned sites = 319 Number in coding regions = 92 Number in noncoding regions = 227 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 AGCTGACTTGCGTTCAAACTTTCTGGGA 1 9 1 TGCGTTCAAA 0.97373 -127 TTTTTTAGAATGTGCTCGAGTTGAGTAGCA 1 51 1 TGTGCTCGAG 0.985567 -85 AAGAGGGTTATGCGCTCATTAGCAGCATTG 1 106 0 TGCGCTCATT 0.968616 -30 CATAACCCTCTTTGTCCGAGGT 1 124 1 TTTGTCCGAG 0.951003 -12 GGCGAGCAATGCGTCAAAGTGTTGTTGAT 2 10 1 TGCGTCAAAG 0.974417 -32 GGTACCGTAATGCGTCCGTTAATGTCGGTA 3 18 0 TGCGTCCGTT 0.989205 -40 ********** Masking position 1 Map Score: 5.14449 Number of sites scoring better than the average of aligned sites = 422 Number in coding regions = 134 Number in noncoding regions = 288 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 CTGGGAATATGCAGCGGCTTTTTTAGAATG 1 33 1 GCAGCGGCTT 0.997093 -103 GAGTTGAGTAGCAACCGCTTTTGGCGAGGC 1 68 1 GCAACCGCTT 0.998671 -68 GACGCATTACGGTACCGCTTGGTGGTCGTC 3 32 1 GGTACCGCTT 0.995699 -26 ********** Masking position 9 Map Score: 3.10382 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 6 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 CGTACCGTACCGACATTAACGG 3 3 1 TACCGTACCG 0.99863 -55 ACGGACGCATTACGGTACCGCTTGGTGGTC 3 29 1 TACGGTACCG 0.99863 -29 ********** Masking position 6 Map Score: 1.61687 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 1 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 TAAAAAAGCCGCTGCATATTCCCAGAAAGTTTG 1 25 0 GCTGCAATCC 0.995435 -111 GCCAAAAGCGGTTGCTACTCAACTCGAGCACAT 1 60 0 GTTGCTCTAC 0.914754 -76 TGTTTGCAATGCTGCTAATGAGCGCATAACCCT 1 100 1 GCTGCTATAC 0.936137 -36 GCGTCAAAGTGTTGTTGATTCTCGCTGGTTT 2 21 1 GTTGTTATCC 0.988637 -21 ****** ** * * Masking position 9 Map Score: 1.28684 Number of sites scoring better than the average of aligned sites = 55 Number in coding regions = 8 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 TTTTTAGAATGTGCTCGAGTTGAGTAGCAAC 1 52 1 GTGTCGAGTT 0.981429 -84 AACCGCTTTTGGCGAGGCGTTGTTTGCAATG 1 80 1 GGCAGGCGTT 0.98525 -56 CGAGCAATGCGTCAAAGTGTTGTTGATTCTC 2 13 1 GTCAAGTGTT 0.989196 -29 CCGCTTGGTGGTCGTCGTGTTA 3 46 1 GTCTCGTGTT 0.995998 -12 *** ******* Masking position 10 Map Score: 0.227105 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 12 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0