AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i033_tpal_bbur_100.orf -o033_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00331 75 AE000520 #2 RTP00330 224 AE000520 Motif number 1 AAGCACTGGATGGGCTAGGGGGTTTCATCGCCT 1 24 1 TGGGTGGGGT 0.99559 -52 AGAGTTTGATTGGGTTTGGTAGGCGATGAAACC 1 44 0 TGGGTGGAGG 0.996437 -32 TAGTGGCGAGCGAAATTGGAGGAGCCTAAACCT 2 66 1 CGAATGGGGA 0.923781 -159 TGTGTCTAACAGGGGTTGTAGGGCCGCGCGGGC 2 98 1 AGGGTGTGGG 0.982917 -127 CGCGCGGGCTTGCGTTCGGTGGGTGAAATAATC 2 122 1 TGCGTGGGGG 0.99869 -103 AAAACCTTTCTGCTATAGGCCGGATTATTTCAC 2 144 0 TGCTTGGCGG 0.987062 -81 TCCCCGTATGCGGAATGGGGCGGACCTGCTGG 2 203 1 CGGATGGCGG 0.995339 -22 **** * ** *** Masking position 6 Map Score: 8.62306 Number of sites scoring better than the average of aligned sites = 926 Number in coding regions = 287 Number in noncoding regions = 639 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 GGATGGGCTAGGGGGTTTCATCGCCTACCA 1 31 1 GGGGGTTTCA 0.976272 -45 CCGGCATTCAGAGTTTGATT 1 66 0 CCGGCATTCA 0.951312 -10 AAGAAATCAAGAGAGATTCCGAAAGTAGTG 2 41 1 GAGAGATTCC 0.842019 -184 GCAAGCCCGCGCGGCCCTACAACCCCTGTT 2 105 0 GCGGCCCTAC 0.96521 -120 GTAGGGCCGCGCGGGCTTGCGTTCGGTGGG 2 115 1 GCGGGCTTGC 0.98542 -110 CCCTCTCTGTCAGGCTTTCCCAAAACCTTT 2 168 0 CAGGCTTTCC 0.96032 -57 TTCCGCATACGGGGATTTCACCCTCTCTGT 2 188 0 GGGGATTTCA 0.948264 -37 GCGGAATGGGGCGGACCTGCTGG 2 212 1 GCGGACCTGC 0.933755 -13 ********** Masking position 8 Map Score: 5.14549 Number of sites scoring better than the average of aligned sites = 2473 Number in coding regions = 730 Number in noncoding regions = 1743 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 3 ACTGTCGGAGGTAAAGCACTG 1 2 1 CTGTCGGAGG 0.993378 -74 CCGGCATTCAGAGTTTGATTGGGT 1 62 0 CATTCAGAGT 0.955792 -14 CTCGCCACTACTTTCGGAATCTCTCTTGAT 2 46 0 CTTTCGGAAT 0.914187 -179 AAACCTGTGTCTAACAGGGGTTGTAGGGCC 2 93 1 CTAACAGGGG 0.946203 -132 CGCGGGCTTGCGTTCGGTGGGTGAAATAAT 2 124 1 CGTTCGGTGG 0.962321 -101 TTGGGAAAGCCTGACAGAGAGGGTGAAATC 2 175 1 CTGACAGAGA 0.962524 -50 CCCCATTCCGCATACGGGGATTTCACCCTC 2 193 0 CATACGGGGA 0.96602 -32 ********** Masking position 5 Map Score: 4.555 Number of sites scoring better than the average of aligned sites = 1135 Number in coding regions = 319 Number in noncoding regions = 816 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 AGGGGGTTTCATCGCCTACCAAACCCAATC 1 40 1 ATCGCCTACC 0.980276 -36 CTCCTCCAATTTCGCTCGCCACTACTTTCG 2 60 0 TTCGCTCGCC 0.990595 -165 GCCGGATTATTTCACCCACCGAACGCAAGC 2 129 0 TTCACCCACC 0.996909 -96 ATACGGGGATTTCACCCTCTCTGTCAGGCT 2 182 0 TTCACCCTCT 0.978743 -43 ********** Masking position 2 Map Score: 2.37516 Number of sites scoring better than the average of aligned sites = 384 Number in coding regions = 113 Number in noncoding regions = 271 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 CCTCCAATTTCGCTCGCCACTACTTTCGGA 2 58 0 CGCTCGCCAC 0.99514 -167 AACGCAAGCCCGCGCGGCCCTACAACCCCT 2 108 0 CGCGCGGCCC 0.872342 -117 CCAGCAGGTCCGCCCCATTCCGCATA 2 209 0 GGTCCGCCCC 0.62027 -16 ********** Masking position 5 Map Score: 0.305521 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 12 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0