AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i033_tpal_bbur_300.orf -o033_tpal_bbur_300.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00331 75 AE000520 #2 RTP00330 224 AE000520 Motif number 1 AAGCACTGGATGGGCTAGGGGGTTTCATCGCCT 1 24 1 TGGGTGGGGT 0.995493 -52 AGAGTTTGATTGGGTTTGGTAGGCGATGAAACC 1 44 0 TGGGTGGAGG 0.996358 -32 TAGTGGCGAGCGAAATTGGAGGAGCCTAAACCT 2 66 1 CGAATGGGGA 0.922222 -159 TGTGTCTAACAGGGGTTGTAGGGCCGCGCGGGC 2 98 1 AGGGTGTGGG 0.982545 -127 CGCGCGGGCTTGCGTTCGGTGGGTGAAATAATC 2 122 1 TGCGTGGGGG 0.998661 -103 AAAACCTTTCTGCTATAGGCCGGATTATTTCAC 2 144 0 TGCTTGGCGG 0.98678 -81 TCCCCGTATGCGGAATGGGGCGGACCTGCTGG 2 203 1 CGGATGGCGG 0.995237 -22 **** * ** *** Masking position 6 Map Score: 8.62306 Number of sites scoring better than the average of aligned sites = 926 Number in coding regions = 287 Number in noncoding regions = 639 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 TGGTAGGCGATGAAACCCCCTAGCCCATCC 1 31 0 TGAAACCCCC 0.975222 -45 AATCAAACTCTGAATGCCGG 1 66 1 TGAATGCCGG 0.949194 -10 CACTACTTTCGGAATCTCTCTTGATTTCTT 2 41 0 GGAATCTCTC 0.835969 -184 AACAGGGGTTGTAGGGCCGCGCGGGCTTGC 2 105 1 GTAGGGCCGC 0.963689 -120 CCCACCGAACGCAAGCCCGCGCGGCCCTAC 2 115 0 GCAAGCCCGC 0.985397 -110 AAAGGTTTTGGGAAAGCCTGACAGAGAGGG 2 168 1 GGAAAGCCTG 0.958577 -57 ACAGAGAGGGTGAAATCCCCGTATGCGGAA 2 188 1 TGAAATCCCC 0.946028 -37 CCAGCAGGTCCGCCCCATTCCGC 2 212 0 GCAGGTCCGC 0.934045 -13 ********** Masking position 3 Map Score: 5.14549 Number of sites scoring better than the average of aligned sites = 2473 Number in coding regions = 730 Number in noncoding regions = 1743 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 3 ACTGTCGGAGGTAAAGCACTG 1 2 1 CTGTCGGAGG 0.99279 -74 CCGGCATTCAGAGTTTGATTGGGT 1 62 0 CATTCAGAGT 0.951752 -14 CTCGCCACTACTTTCGGAATCTCTCTTGAT 2 46 0 CTTTCGGAAT 0.906909 -179 AAACCTGTGTCTAACAGGGGTTGTAGGGCC 2 93 1 CTAACAGGGG 0.94134 -132 CGCGGGCTTGCGTTCGGTGGGTGAAATAAT 2 124 1 CGTTCGGTGG 0.958893 -101 TTGGGAAAGCCTGACAGAGAGGGTGAAATC 2 175 1 CTGACAGAGA 0.959073 -50 CCCCATTCCGCATACGGGGATTTCACCCTC 2 193 0 CATACGGGGA 0.962879 -32 ********** Masking position 5 Map Score: 4.555 Number of sites scoring better than the average of aligned sites = 1135 Number in coding regions = 319 Number in noncoding regions = 816 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 AGGGGGTTTCATCGCCTACCAAACCCAATC 1 40 1 ATCGCCTACC 0.981972 -36 CTCCTCCAATTTCGCTCGCCACTACTTTCG 2 60 0 TTCGCTCGCC 0.991408 -165 GCCGGATTATTTCACCCACCGAACGCAAGC 2 129 0 TTCACCCACC 0.997179 -96 ATACGGGGATTTCACCCTCTCTGTCAGGCT 2 182 0 TTCACCCTCT 0.980569 -43 ********** Masking position 2 Map Score: 2.37516 Number of sites scoring better than the average of aligned sites = 384 Number in coding regions = 113 Number in noncoding regions = 271 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 CCTCCAATTTCGCTCGCCACTACTTTCGGA 2 58 0 CGCTCGCCAC 0.995328 -167 AACGCAAGCCCGCGCGGCCCTACAACCCCT 2 108 0 CGCGCGGCCC 0.866361 -117 CCAGCAGGTCCGCCCCATTCCGCATA 2 209 0 GGTCCGCCCC 0.614673 -16 ********** Masking position 5 Map Score: 0.305521 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 12 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0